We narrowed to 17,094 results for: Green Fluorescent Protein
-
Plasmid#251233PurposeDrug inducible gene editing system based on TnpB (Little Prince)DepositorInsertH1-TetO-TnpB ωRNA* scaffold; Core EF1α-opTtetR; TnpB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
Little Prince (enIscB)
Plasmid#251234PurposeDrug inducible gene editing system based on enIscB (Little Prince)DepositorInsertH1-TetO-enIscB ωRNA* scaffold; Core EF1α-opTtetR; enIscB; NES; StaPLs-TI; 3×BPNLS; GFP
UseAAV and CRISPRExpressionMammalianAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
SAGA045
Plasmid#240794PurposePlasmid contains the triple selection cassette gfp -pBR322ROP tetApBR322ROP - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA pBR322ROP His low : T7- His tags low - gfp -pBR322ROP tetApBR322ROP - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA042
Plasmid#240791PurposePlasmid contains the triple selection cassette gfp -p15a tetAp15a - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA p15a His low : T7- His tags low - gfp -p15a tetAp15a - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SAGA039
Plasmid#240788PurposePlasmid contains the triple selection cassette gfp -RK2 tetARK2 - CmTrunc that allows for in vivo recombineering in E.coli.DepositorInsertSAGA RK2 His low : T7- His tags low - gfp -RK2 tetARK2 - CmTrunc
UseSynthetic BiologyMutationMutation on translation initiation region of tetAAvailable sinceAug. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
LEGO-GM55
Plasmid#217413PurposeLuciferase expression vector with the minimal GM-CSF promoterDepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoterHuman -55 to +28 minimal CSF2 promoterAvailable sinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)13
Plasmid#127526PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase 13 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase 13 attachment sites.
ExpressionPlantAvailable sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMTG8-Amp-FRT
Plasmid#128277PurposeTIP-LITer2.0-KRAS(G12V) gene circuit with the following architecture: CMV-TetOx2-TetR-LOV-TIP-P2A-KRAS(G12V)-P2AGFPDepositorInsertsTetR-LOV-TIP
EGFP
KRAS(G12V)
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable sinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF CAG luc-EGFP-cre puro
Plasmid#67503PurposeConstitutive expression of a firefly luciferase-enhanced green fluorescent protein-cre recombinase fusion protein in mammalian cellsDepositorInsertluciferase-EGFP-cre
UseCre/Lox, Lentiviral, and Luciferase ; Fluorescent…ExpressionMammalianPromoterCAGAvailable sinceFeb. 17, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBAD-SPW-RHH
Plasmid#190630PurposeBacterial expression of genetically encoded protease indicator SPW-RHHDepositorInsertSPW-RHH
ExpressionBacterialAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-SCW-HHL
Plasmid#190634PurposeMammalian expression of genetically encoded calcium indicator SCW-HHLDepositorInsertSCW-HHL
ExpressionMammalianAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD-SKW-HHL
Plasmid#190632PurposeBacterial expression of genetically encoded potassium indicator SKW-HHLDepositorInsertSKW-HHL
ExpressionBacterialAvailable sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-ro4GFP
Plasmid#82368PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertro4GFP
Tags6xHISExpressionBacterialMutationC48S/S65T/Q80R/N149C/S202CPromoterT7Available sinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSETB-ro3GFP
Plasmid#82367PurposeInducible expression of redox sensitive GFP in bacteriaDepositorInsertro3GFP
Tags6xHISExpressionBacterialMutationC48S/Q80R/N149C/S202CPromoterT7Available sinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRE-BI-hGRAD
Plasmid#207837PurposeInducible hGRAD Plasmids for rapid depletion of GFP-tagged proteins in mammalian cellsDepositorInsertsExpressionMammalianMutation215 amino acids of the full length proteinPromoterTRE3G BI promoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-eGFP-beta 2 CP
Plasmid#13298DepositorAvailable sinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGT2
Plasmid#13056DepositorTypeEmpty backboneExpressionBacterialAvailable sinceDec. 8, 2006AvailabilityAcademic Institutions and Nonprofits only -
pR2Q191y
Plasmid#101029Purposefluorescent, functional, glutamate receptor subunitDepositorInsertGlutamate receptor subunit (Gria2 Rat)
Tagsfluorescent proteinExpressionMammalianMutationtagged with fluorescent proteinPromoterCMVAvailable sinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only