We narrowed to 2,225 results for: PAM
-
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPHAGE-CR-PINK1-C-TAP
Plasmid#128510PurposeLentiviral constitutive expression of CRISPR-resistant PINK1 with c-terminal FLAG and HA tag.DepositorInsertPTEN induced kinase 1 (PINK1 Human)
UseLentiviralTagsFLAG and HA tagsExpressionMammalianMutationSynonymous silent mutation in Q5 to render sgRNA …PromoterCMVAvailable SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
Antibody#213670-rAbPurposeAnti-Integrin α4 (Mouse) chimeric recombinant antibody with fused rat variable and rabbit constant domains; binds α4 subunit.DepositorRecommended ApplicationsFlow CytometryReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 1, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral Prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Yeast GoldenBraid Cloning System and Toolkit
Plasmid Kit#1000000138PurposeThis toolkit allows generation of transcriptional units using GoldenBraid for integration in the S. cerevisiae genome at loci, YPRCΔ15 and YORWΔ22, to support high and stable transgene expression.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden Gate (GoldenBraid)Available SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPS808
Plasmid#8856DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS809
Plasmid#8935DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pPS810
Plasmid#8936DepositorTypeEmpty backboneTagsGFPExpressionYeastAvailable SinceAug. 19, 2005AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
p35S:TN3-YFPn
Plasmid#102407Purposesplit YFP. Plant expression of p35S:TN3-YFPnDepositorInsertTN3
TagsYFPnExpressionPlantPromoter35SAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-RdLight1 (AAV9)
Viral Prep#125708-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSynapsin1-RdLight1 (#125708). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-RdLight1 plasmid DNA. Synapsin-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-RdLight1 (AAV9)
Viral Prep#125707-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-RdLight1 (#125707). In addition to the viral particles, you will also receive purified pAAV-CAG-RdLight1 plasmid DNA. CAG-driven expression of red genetically encoded dopamine sensor RdLight1. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-dLight1.3b (AAV9)
Viral Prep#135762-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-syn-dLight1.3b (#135762). In addition to the viral particles, you will also receive purified pAAV-syn-dLight1.3b plasmid DNA. Syn-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA2m (AAV9)
Viral Prep#140553-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA2m (#140553). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA2m plasmid DNA. Synapsin-driven expression of 2nd generation medium affinity dopamine sensor GRAB_rDA2m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA1h (AAV9)
Viral Prep#140557-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_rDA1h (#140557). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_rDA1h plasmid DNA. Synapsin-driven expression of red fluorescent, high affinity dopamine sensor GRAB_rDA1h. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV5)
Viral Prep#125560-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA1m (AAV9)
Viral Prep#140556-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_rDA1m (#140556). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_rDA1m plasmid DNA. Synapsin-driven expression of red fluorescent medium affinity dopamine sensor GRAB_rDA1m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV9)
Viral Prep#125560-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA2h (AAV9)
Viral Prep#140554-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA2h (#140554). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA2h plasmid DNA. Synapsin-driven expression of high-affinity GRAB_DA2h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dLight1.1 (AAV1)
Viral Prep#111066-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-dLight1.1 (#111066). In addition to the viral particles, you will also receive purified pAAV-hSyn-dLight1.1 plasmid DNA. hSyn-driven expression of dLight1.1 dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.3b (AAV1)
Viral Prep#125560-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA. CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.2 (AAV1)
Viral Prep#111069-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-dLight1.2 (#111069). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.2 plasmid DNA. CAG-driven expression of dLight1.2 dopamine sensor. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hDAT
Plasmid#32810DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
PA-mCherry1-Lifeact-7
Plasmid#54492PurposeLocalization: Actin, Excitation: 400 / 504, Emission: 515 / 517DepositorInsertLifeact-PAmCherry1
ExpressionMammalianAvailable SinceJune 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV9)
Viral Prep#113050-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dLight1.2 (AAV5)
Viral Prep#111068-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-dLight1.2 (#111068). In addition to the viral particles, you will also receive purified pAAV-hSyn-dLight1.2 plasmid DNA. Synapsin-driven expression of dLight1.2 dopamine sensor. This sensor has a slightly increased dynamic range and is better for 2P imaging in vivo. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.1 (AAV5)
Viral Prep#111067-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-dLight1.1 (#111067). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.1 plasmid DNA. CAG-driven expression of dLight1.1 dopamine sensor. This sensor is recommended for photometry in vivo. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceDec. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1m (AAV9)
Viral Prep#113049-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_DA1m (#113049). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1m plasmid DNA. Synapsin-driven expression of GRAB-DA1m dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_rDA-mut (AAV9)
Viral Prep#140558-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_rDA-mut (#140558). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_rDA-mut plasmid DNA. Synapsin-driven expression of control red fluorescent dopamine sensor GRAB_rDA-mut (does not respond to DA). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-dLight1.2 (AAV1)
Viral Prep#111068-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-dLight1.2 (#111068). In addition to the viral particles, you will also receive purified pAAV-hSyn-dLight1.2 plasmid DNA. Synapsin-driven expression of dLight1.2 dopamine sensor. This sensor has a slightly increased dynamic range and is better for 2P imaging in vivo. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA-mut (AAV9)
Viral Prep#140555-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA-mut (#140555). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA-mut plasmid DNA. Synapsin-driven expression of control dopamine sensor GRAB_DA-mut (does not respond to DA). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-dLight1.1 (AAV1)
Viral Prep#111067-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-dLight1.1 (#111067). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.1 plasmid DNA. CAG-driven expression of dLight1.1 dopamine sensor. This sensor is recommended for photometry in vivo. These AAV preparations are suitable purity for injection into animals.DepositorAvailable SinceMarch 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
OTV-dDAT
Plasmid#32812DepositorAvailable SinceDec. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
R777-E269 Hs.RASSF9
Plasmid#70553PurposeGateway ORF clone of human RASSF9 [NM_005447.3] with stop codon (for native or N-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_DA1h (AAV Retrograde)
Viral Prep#113050-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-GRAB_DA1h (#113050). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_DA1h plasmid DNA. Synapsin-driven expression of GRAB-DA1h dopamine sensor in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
R777-E270 Hs.RASSF9-nostop
Plasmid#70554PurposeGateway ORF clone of human RASSF9 [NM_005447.3] without stop codon (for C-terminal fusions)DepositorInsertRASSF9 (RASSF9 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p35S::ARA6/RabF1-YFPc
Plasmid#102408Purposesplit YFP. Plant expression of p35S::ARA6/RabF1-YFPcDepositorAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
SQ171/pRibo-T
Plasmid#69342PurposeSQ171 strain supported by pRibo-T plasmidDepositorInsertRibo-T
ExpressionBacterialAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAcGP67A - murine TfR
Plasmid#12392DepositorInserttransferrin receptor (Tfrc Mouse)
Tags6X-His tag, Factor Xa cleavage site, and leader p…ExpressionInsectMutationSee comments sectionAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only