We narrowed to 16,162 results for: grna
- 
  Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only - 
  
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
Chr1q_Cassette-Integration_gRNA
Plasmid#195126PurposegRNA in a third generation Cas9 vector with GFP, targeting location downstream of Chr1q_centromere-targeting_gRNA for positive-negative selection cassette integrationDepositorInsertChr1q gRNA
ExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
AAVS1_Cas9-hGem_gRNA2
Plasmid#217659Purposeexpresses Cas9-hGem and guideRNA targeting the human AAVS1 safe harbour locusDepositorInsertsgRNA2 targeting the human AAVS1 safe harbour locus
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only - 
  
sgRNA with U6 promoter
Plasmid#48962Purposeto drive the sgRNA expression under a U6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionWormPromoterU6Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only - 
  
LentiGuidPuro-hTP73_sgRNA-1
Plasmid#88855PurposeCRISPR KO of Trp73DepositorInsertTrp73
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
pH-PABE-7-sgRNA
Plasmid#115621PurposeTargeted A to G in riceDepositorInsertwtTadA-TadA7.10-nCas9-3*NLS
UseCRISPRExpressionPlantAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only - 
  
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
4 gRNA concatemer
Plasmid#84881PurposeEmpty concatmer vector in which 4 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
AM77_pU6.Sa-gRNA.CLYBL
Plasmid#199237PurposeExpression construct encoding a S. aureus guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. aureus gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pPEPX-P3-sgRNAluc
Plasmid#85590PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template forDepositorInsertsgRNA targeting firefly luciferase encoding gene
UseCRISPRExpressionBacterialPromoterP3Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only - 
  
pgRNA-R-gfp
Plasmid#220927PurposeExpresses gfp using J23119 promoter and pgRNA_AT backboneDepositorInsertsuperfolder GFP
TagsFLAGExpressionBacterialPromoterJ23119Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pBSV2_Psyn-sgRNA500
Plasmid#149613PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
2 gRNA concatmer
Plasmid#84879PurposeEmpty concatmer vector in which 2 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only