We narrowed to 19,825 results for: INO
-
Plasmid#205631PurposeExpression of TnpBmax in mammalian cellsDepositorInsertISDra2-TnpB optimized for mammalian expression
TagsNLS-3xFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-hSNCA
Plasmid#185715PurposeAAV expression of GFP and human α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CIBN-CAAX
Plasmid#79574Purposeexpression of N-terminal portion of CIB1 with a C-terminal CAAX box from KRras for plasma-membrane targetingDepositorInsertCIBN (CIB1 Mustard Weed)
TagsC-terminal CAAX-boxExpressionMammalianMutationK93A, R94A, K106A, K107A (please see depositor co…PromoterCMVAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-TDP-43
Plasmid#190093PurposeExpresses TDP-43 in mammalian cells. Note: EGFP and TDP-43 are expressed in different reading frames.DepositorInsertTAR DNA-Binding Protein 43 (TARDBP Human)
ExpressionMammalianAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
iOn-CAG∞MCS
Plasmid#154013PurposeExpression vector based on the iOn integration-coupled transcriptional switch (Kumamoto et al bioRxiv 2019), equipped with an MCS to clone-in genes of interest and express it from a CAG promoterDepositorInsertMCS
ExpressionMammalianPromoterCAGAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1994
Plasmid#49124PurposeAAV plasmid with S100B (Ple266) promoter driving expression of iCre.DepositorInsertssAAV-Ple266-iCre
UseAAVExpressionMammalianPromoterS100BAvailable SinceMay 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pHR-SFFV-dCas9-BFP
Plasmid#46910PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFPDepositorInsertdCas9-BFP fusion
UseCRISPR and LentiviralTags2xNLS, BFP, and HAExpressionMammalianPromoterSFFVAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA
Plasmid#185714PurposeAAV expression of GFP and mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pRK5-FLAG-FNIP2
Plasmid#72294PurposeoverexpressionDepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV5B-HA-Smad2
Plasmid#11734DepositorAvailable SinceAug. 3, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IPU-GFP-MYH9
Plasmid#168273PurposeExpresses MYH9 in mammalian cellsDepositorAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPC-LaminA
Plasmid#69059Purposeencodes the LaminA-CS proteinDepositorAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTFG011_Spike_Parental_D614G_3xFlag
Plasmid#191571PurposeSARS-CoV-2 Spike protein under CMV with D614G, C-term 19 amino acid truncation, and 3x FLAG. For expression and pseudotyping lentiviral particles.DepositorInsertSARS-CoV-2 Spike Protein (S Synthetic)
Tags3x FLAGExpressionMammalianMutationD614G mutation. Last 19 amino acids truncated.PromoterCMVAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNatA (pACYCduet-naa10-naa15)
Plasmid#72928PurposeAllows expression of a modified version of the fission yeast NatA complex - chloramphenicol markerDepositorExpressionBacterialMutationCodon optomised for E.coli expressionPromoterT7Available SinceFeb. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
HyperADAR control
Plasmid#166969PurposeExpress the Hyperactive catalytic domain of Drosophila ADAR and linker at the 5' end of this domain, in the MSCV-IRES-GFPDepositorInsertlinker-hyperADAR
UseRetroviralTagslinker-HyperADARExpressionMammalianPromoterMSCVAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only