We narrowed to 14,051 results for: crispr grnas
-
Plasmid#106315PurposeExpress Cas9 and sgRNA targeting mShmt2DepositorInsertsgRNA targeting mShmt2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT2_2
Plasmid#106310PurposeExpress Cas9 and sgRNA targeting SHMT2DepositorInsertsgRNA targeting SHMT2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTHFD1L_2
Plasmid#106317PurposeExpress Cas9 and sgRNA targeting MTHFD1LDepositorInsertsgRNA targeting MTHFD1L
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-dCas9
Plasmid#112233PurposeLentiviral plasmid for expression of gRNA and dCas9 in mammalian cells; derivative of lentiCRISPR v2DepositorInsertsdCas9
Porumycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationChanged: Aspartic acid 10 to Glycine, Histidine 8…PromoterEFS-NSAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgIRF3#5
Plasmid#127642PurposeKnock-out of human IRF3DepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgBLM10
Plasmid#127643PurposeKnock-out of human BLMDepositorInsertIRF3 sgRNA (IRF3 Human)
UseLentiviralAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-1
Plasmid#86128PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-1
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Ccu-sgRNA-SV40-puro
Plasmid#192130PurposeExpresses Ccu-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertCcu-SgRNA scaffold
ExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSK-mU6-Hsp1-sgRNA-SV40-puro
Plasmid#192129PurposeExpresses Hsp1-SgRNA scaffold cloned with BbsI and puromycin resistance geneDepositorInsertHsp1-SgRNA scaffold
ExpressionMammalianAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_ST-sgRNA
Plasmid#188705PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and 4 sgRNAs targeting human safe targeting lociDepositorInsertST sgRNAs
UseLentiviralExpressionMammalianPromoterhUbCAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL007-NANOG-sgRNA
Plasmid#175555PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse NANOG locus.DepositorInsertspCas9-nuclease and sgRNA against mouse NANOG STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only