We narrowed to 6,854 results for: itch
-
Plasmid#227333PurposeMMEJ Donor template for mStayGold-2A-Puro insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Short Homology Arms flanking a mStayGold-2A-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-miRFP670nano3-H2BC11
Plasmid#227331PurposeDonor template for miRFP670nano3 insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a miRFP670nano3 Tag (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-H2BC11
Plasmid#227330PurposeDonor template for mStayGold insertion into the C-terminus of the H2BC11 locus. For nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 (Addgene #207755)DepositorInsertH2BC11 Homology Arms flanking a mStayGold Tag (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
OptoProfilin.S138E
Plasmid#208287PurposeExpresses Cry2(1-531)-mCherry-Profilin.S138EDepositorTagsmCherryExpressionMammalianMutationSer 138 (sometimes numbered 137) mutated to GluPromoterCMVAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
OptoProfilin.S138A
Plasmid#208288PurposeExpresses Cry2(1-531)-mCherry-Profilin.S138ADepositorTagsmCherryExpressionMammalianMutationSer 138 (sometimes numbered 137) mutated to AlaPromoterCMVAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
PHR-GFP-STAT2
Plasmid#183931PurposeOptogenetic PHR domain coupled to GFP and STAT2 activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-Rta
Plasmid#183930PurposeOptogenetic PHR domain coupled to GFP and Rta activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-VPR
Plasmid#183928PurposeOptogenetic PHR domain coupled to GFP and VPR activation domain; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-FUSN
Plasmid#183932PurposeOptogenetic PHR domain coupled to GFP and FUSN domain with a high phase separation propensity; binds to CIBN upon blue light exposureDepositorAvailable SinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
LIC-Z-delCry2
Plasmid#153545Purposethis is the non-clustering version of LIC-Z tagged with mcherryDepositorInserthuman TCR ζ-Chain (CD247 Human)
TagsmCherryExpressionMammalianMutationwith Cry2 sequence deleted from LIC-ZPromoterCMVAvailable SinceJuly 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRY-GalVP16 (B695)
Plasmid#92031PurposeExpresses CRY2 (full length, intact NLS) fusion with Gal4DBD(aa1-147) fused to VP16AD (truncated), downstream of mCherry-IRES.DepositorAvailable SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
Kif5A-GFP-CIBN
Plasmid#102252PurposeExpresses fusion of kinesin heavy chain 5A (1-572) with GFP and CIB1 (1-170)DepositorAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRY2-mCherry-Miro1TM
Plasmid#102247PurposeExpresses fusion of CRY2PHR with mCherry and transmembrane domain of Miro1DepositorAvailable SinceNov. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-FIRE-pHLy
Plasmid#170774PurposeRatiometric biosensor expressed with UbC promoter for probing lysosomal pH in mammalian cellsDepositorInsertLAMP1 (LAMP1 Human)
UseLentiviralTagsmCherry and mTFP1ExpressionMammalianMutation84 nucleotide Signal Sequence switched to the beg…PromoterhUbCAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FIRE-pHLy
Plasmid#170775PurposeRatiometric biosensor expressed with CMV promoter for probing lysosomal pH in mammalian cellsDepositorInsertLAMP1 (LAMP1 Human)
UseLentiviralTagsmCherry and mTFP1ExpressionMammalianMutation84 nucleotide Signal Sequence switched to the beg…PromoterCMVAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2WT
Plasmid#101223PurposeFUS(1-214) fused to mCh-Cry2WTDepositorAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-FUSN-mCh-Cry2olig
Plasmid#101224PurposeFUS(1-214) fused to mCh-Cry2oligDepositorInsertFUS(aa1-214) (FUS Human)
UseLentiviralTagsmCherry-Cry2oligExpressionMammalianPromoterSFFVAvailable SinceFeb. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
iCas
Plasmid#84232PurposeExpression of SpCas9 with 4 ERT2 fusion protein and empty gRNA cassette. The activity of Cas9 can be switched on and off in human cells with 4-hydroxytamoxifen (4-HT)DepositorInsertCas9
Tags2A-OFP co-expression and ERT2-ERT2ExpressionMammalianPromoterCMVAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only