We narrowed to 6,893 results for: poly
-
Plasmid#68209PurposeProvides the O. sativa U3 RNA polIII promoter as a level 0 GoldenBraid partDepositorInsertOsU3 promoter
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Nectin-3 in situ probe
Plasmid#45633DepositorInsertNectin-3 in situ probe (Nectin3 Mouse)
UseIn situMutationfragment contains bp# 1626-2039 of NM_021495Available SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
rEcoli XpS
Bacterial Strain#192872PurposeMG1655-C321 -- All 321 UAG codons changed to UAADepositorBacterial ResistanceBleocin (Zeocin)SpeciesEscherichia coliAvailable SinceDec. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CC1215
Bacterial Strain#79062PurposeBL21(DE3)-based E. coli purine auxotrophic host strain used for the preparation of PurE proteins in a purE background.DepositorBacterial ResistanceKanamycinAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_eGFP
Plasmid#135474PurposeEncodes Marburg virus minigenome with eGFP reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, eGFP reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AY27_pU6.gRNA.CLYBL
Plasmid#199238PurposeExpression construct encoding a S. pyogenes guide RNA targeting the human CLYBL safe harbor locusDepositorInsertS. pyogenes gRNA spacer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNAAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV GAG
Plasmid#234992PurposeFor production of Viral like particles (VLPs) by expressing the MLV GAG protein in mammalian cellsDepositorInsertGAG
ExpressionMammalianMutationDeleted polymerase coding sequenceAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 Lysosomal-METRIQ
Plasmid#135401PurposeExpresses lysosomal-METRIQ (DNAse II-sfGFP together with cytosolic RFP) to measure lysosomal activityDepositorInsertDNAse II alpha (DNASE2 Human)
UseLentiviralTagsT2A, mCherry, and sfGFPExpressionMammalianMutationSingle-nucleotide polymorphism C432TAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV13_pCAG.Cas9.gRNA.NT
Plasmid#199260PurposeExpression construct encoding SpCas9 nuclease and a control non-targeting guide RNADepositorInsertsSpCas9 nuclease
Non-targeting (NT) control gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAV5B+longBRD4
Plasmid#157792PurposeExpression of long isoform of BRD4DepositorAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GST-TBK1
Plasmid#221331PurposeTBK1 protein overexpression in Sf9 insect cellsDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
enIscB
Plasmid#205410PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_Flag_SV40NLS_OgeuIscB*_npNLS_polyA_pU6__RNA*_pCMV_mCherry
ExpressionMammalianMutationE85R+H369R+S387R+S457RPromoterCAG, hU6, CMVAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-eGFP-dspB(E184Q W330Y)-6xHis
Plasmid#175801PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein eGFP-DspB(E184Q W330Y), used as a non-binding control for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAviTag, Hexahistidine tag, and eGFPExpressionBacterialMutationE184Q W330YPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HT JS-Rab10wt
Plasmid#135557PurposeExpress mouse Rab10wt in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Rab10wt.DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
His-GFP-Clathrin
Plasmid#170858PurposeMammalian expression of His-GFP-Clathrin.DepositorInsertClathrin light polypeptide (Lca) (Clta Mouse)
Tags(His)6 and EGFPExpressionMammalianPromoterCMVAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
p2,0_3M5M_luciferase
Plasmid#135475PurposeEncodes Marburg virus minigenome with luciferase reporter gene under control of a T7 RNA polymerase promoterDepositorInsertMarburg virus minigenome, luciferase reporter
ExpressionMammalianMutationNonePromoterT7Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
6691 Bicistronic_ires_puro
Plasmid#64335PurposeThis a retroviral expression plasmid with a minimal polylinker followed by IRES and puro resistance geneDepositorTypeEmpty backboneUseRetroviralAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSmart-Kan-HC-EF1a-Nla-Cas8-7-5-11
Plasmid#193752Purposehuman codon optimized Nla-cas8c-Cas7c-Cas5c-Cas11c cloned into pSmart-HC-Kan-EF1a-bGHDepositorInsertEF1a-NlaCas8c-Cas7c-Cas5c-Cas11c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 1, 2023AvailabilityAcademic Institutions and Nonprofits only