We narrowed to 3,364 results for: guide rna expression plasmid

#228958

miniEDV production plasmid. Expresses the miniGag-Cas9 polypeptide (CAG promoter) and sgRNA (human U6 promoter)

Jennifer Doudna

Ngo et al Proc Natl Acad Sci U S A. 2025 Jan 7;122

Jan. 2, 2025

Academic Institutions and Nonprofits only

#91909

Expresses LwCas13a for bacterial expression and contains backbone for spacer cloning

Feng Zhang

Abudayyeh et al Nature. 2017 Oct 4. doi: 10.1038/nature2

Oct. 4, 2017

Industry, Academic Institutions, and Nonprofits

#113972

Single short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#113973

Single short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#113974

Single short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequence

Jordan Green

Rui et al Mol Ther Nucleic Acids. 2020 Apr 21;20:6

March 25, 2021

Academic Institutions and Nonprofits only

#124771

3rd generation lentiviral plasmid to co-express a guide RNA and CyOFP1

Jason Sheltzer

Giuliano et al Curr Protoc Mol Biol. 2019 Sep;128(1):e1

Oct. 11, 2019

Academic Institutions and Nonprofits only

#124772

3rd generation lentiviral plasmid to co-express a guide RNA and mOrange

Jason Sheltzer

Giuliano et al Curr Protoc Mol Biol. 2019 Sep;128(1):e1

Oct. 11, 2019

Academic Institutions and Nonprofits only

#78741

Human expression plasmid for AsCpf1 guide RNA (need to clone in spacer into BsmBI sites)

Keith Joung

Kleinstiver et al Nat Biotechnol. 2016 Jun 27. doi: 10.103

June 16, 2016

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#186773

* Engineered U1 snRNA plasmid for insertion of guide sequences.

Eugene Yeo

Hatch et al Methods. 2022 Jun 25;205:140-148. doi: 1

Aug. 11, 2022

Academic Institutions and Nonprofits only