We narrowed to 11,871 results for: KIN
-
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CLV1 L2_pECIA14
Plasmid#114900PurposePrey vector CLV1 L2_pECIA14 should be used with bait vector CLV1 L2_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
RPK2 X042_pECIA2
Plasmid#115135PurposeBait vector RPK2 X042_pECIA2 should be used with prey vector RPK2 X042_pECIA14.DepositorInsertAT3G02130 (RPK2 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-Mis12-dCEN-Incenp-GFP
Plasmid#108485Purposeinducible expression of vsv-Mis12-dCEN-INCENP-EGFPDepositorInsertMis12-dCEN-INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationCEN box replaced by Mis12PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-CaMKKbeta rat 1-460 K193A
Plasmid#33326DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Rat)
TagsFLAGExpressionMammalianMutationtruncated at 460, K193A (S3V, G96R, and P108L als…PromoterSV40Available SinceApril 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSG5-FLAG-CaMKKbeta rat 1-460 D311A
Plasmid#33325DepositorInsertCalcium/Calmodulin dependent protein kinase kinase beta (Camkk2 Rat)
TagsFLAGExpressionMammalianMutationtruncated at 460, D311A (S3V, G96R, and P108L als…PromoterSV40Available SinceApril 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRExT2A-NT-PmNG
Plasmid#232200PurposeEndogenous tagging of genes by CRISPR/Cas9-mediated homologous recombination; for N-terminal tagging: PAC-3xTy-T2A-3xTy-mNeonGreenDepositorInsertmNeongreen
ExpressionBacterialAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-YAP-wt
Plasmid#229412PurposeLentiviral or overpexression of cDNADepositorAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTn7-SCOUT21.RY
Plasmid#201006PurposepLv1-pUC18R6KT-miniTn7-Gm-mCherry-sYFP2, GmR, ApRDepositorInsertsmcherry
sYFP2
ExpressionBacterialPromoterJ23104Available SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTn7-SCOUT22.RY
Plasmid#201018PurposepLv1-pUC18R6KT-miniTn7-Km-mCherry-sYFP2, KmR, ApRDepositorInsertsmcherry
sYFP2
ExpressionBacterialPromoterJ23104Available SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21b GFP-Rab10 Q68LHis
Plasmid#186015PurposeGFP-Rab10 Q68LHisDepositorInsertGFP-Rab10 Q68LHis (RAB10 Human)
ExpressionBacterialAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-UNC93A_STOP
Plasmid#161448PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertUNC93A (UNC93A Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC47A2_STOP
Plasmid#161405PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC47A2 (SLC47A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC28A2_STOP
Plasmid#161234PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC28A2 (SLC28A2 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
mRuby2-AKTIP
Plasmid#171942PurposeExpresses AKTIP in mammalian cellsDepositorAvailable SinceJuly 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
MBP-TSF-TEVcs-ULK1K46I
Plasmid#171417PurposeFor the purifcation of human ULK1 kinase dead complexDepositorAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B D433N
Plasmid#171823Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B D433NDepositorAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-HaloTag7_dead_mt
Plasmid#167267PurposeOverexpression of the dead variant (D106A) of HaloTag7 in E. coliDepositorInsertHaloTag7
TagsHis x10ExpressionBacterialMutationD106APromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT2R1AtR2NtB2
Plasmid#160886PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T2), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T2
ExpressionBacterialPromoterrbcS-T2: T7, chaperones: T9Available SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SFXN5
Plasmid#132292PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSFXN5 (SFXN5 Human)
ExpressionMammalianAvailable SinceJan. 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits