We narrowed to 9,277 results for: Pol;
-
Plasmid#201547PurposeExpresses a mutant form of human RAD23B that lacks the XPC-binding domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationLacks residues 276-339Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc253
Plasmid#207464PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 253DepositorInsertMTdTc253 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationSer253Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc188
Plasmid#207463PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 188DepositorInsertTdTc188 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys216Ser, Cys302Ala, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc180
Plasmid#207462PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 180DepositorInsertTdTc180 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationGlu180Cys, Cys188Ala, Cys216Ser, Cys302Ala, Cys37…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTc302
Plasmid#207461PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) cysteine variant. Only one surface-exposed cysteine, at residue 302DepositorInsertTdTc302 (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys378Ala, and Cys438SerAvailable SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-rox-inv[Talpha1-iCre-pA]-rox-LynGFP
Plasmid#196874PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-Dre-pA plasmidsDepositorInsertLynGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-lox-inv[Talpha1-Dre-pA]-lox-Lyn-EGFP
Plasmid#196876PurposeNeuron-specific expression of LynGFP reporter. Used in combination with Talpha1-iCre-pA plasmidsDepositorInsertLynEGFP
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196883PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-DIO-inv[roxSTOProx-Lyn-GFP-bGH]
Plasmid#196884PurposeDual Cre/Dre-dependent expression of LynGFP. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-Lyn-GFP-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterQuimeric CAGAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-DIO-inv[roxSTOProx-ZsGreen-bGH]
Plasmid#196886PurposeDual Cre/Dre-dependent expression of ZsGreen. Used as Cre-Dre cotransfection reporterDepositorInsertroxSTOProx-ZsGreen-bGH
UseCre/Lox; Dre/roxExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Halo-Dync1h1motor
Plasmid#191333PurposeExpresses the fluorescently labeled dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Halo-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-FKBP-Dync1h1motor
Plasmid#191332PurposeExpresses the dynein motor domain fused to the dimerization domain FKBP to recruit it to the plasma membrane by using the chemical dimerization system FKBP-FRBDepositorInsertFKBP-Dync1h1motor (Dync1h1 Mouse)
ExpressionMammalianMutationDYNC1H1 motor domain aa 1453-4644Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRX-C751-E3616S
Plasmid#182844Purposemutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG inductionDepositorAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-NQO1(Y128F)
Plasmid#177141PurposeBacterial vector for expression of an N-terminal GST fusion of NQO1(Y128F) with a TEV protease site located between the GST tag and NQO1(Y128F)DepositorAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H163A H258A 3xFLAG-V5
Plasmid#174131PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H163A, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-coHPDL H258A 3xFlag-V5
Plasmid#174130PurposeExpresses codon-optimized catalytically inactive HPDL with a 3xFlag-V5 tag in mammalian cellsDepositorInsert4-hydroxyphenylpyruvate dioxygenase like (HPDL Human)
UseLentiviralTags3xFLAG-V5ExpressionMammalianMutationCodon optimized, H258AAvailable SinceSept. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-DEST42-dre4
Plasmid#170440PurposeExpress drosophila dre4 in E.coli expression system. Generated from pDONR-dre4 by Gateway system. Used for custom antibody purification.DepositorInsertdre4 (dre4 Fly)
Tags6xHis and V5ExpressionBacterialMutationDeleted amino acids 1-20PromoterT7Available SinceJuly 22, 2021AvailabilityAcademic Institutions and Nonprofits only