We narrowed to 11,707 results for: AGA
-
Plasmid#91216Purposeprotoplast vector for targeted deletion of 6 genes in tomatoDepositorInsertgRNAs targeting 6 tomato genes
UseCRISPRExpressionPlantAvailable SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCF821-sgCIDE-42_U6-sgRNA-EF1a-mNeonGreen
Plasmid#211682PurposeU6-sgRNA-EF1a-mNeonGreenDepositorInsertSpyCas9 and sgCIDE-42 guide RNA vector
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_6
Plasmid#155064PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and five intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pED7x26
Plasmid#134813PurposeStringent phage propagation reporter containing pIII-16-29-34-TAGADepositorInsertpIII 16-TAGA 29-TAGA 34-TAGA
UseSynthetic BiologyExpressionBacterialMutation16-TAGA 29-TAGA 34-TAGAAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK01_Rho_minprox_DsREd
Plasmid#173489PurposePCR template for reporter gene with mouse Rhodopsin promoter with DsRedDepositorInsertMouse Rhodopsin promoter driving DsRed reporter gene
ExpressionMammalianPromoterMouse RhodopsinAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn1-iCre-P2A-mRuby3
Plasmid#235248PurposeAAV-mediated expression of iCre and mRuby3 in mammalian cellsDepositorInsertsiCre
mRuby3
UseAAV and Cre/LoxExpressionMammalianPromoterhsyn1Available SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-jGCaMP8m-P2A-CyRFP1-WPRE
Plasmid#235249PurposeAAV-mediated and Cre-dependent expression of jGCaMP8m and CyRFP1 in mammalian cellsDepositorInsertsjGCaMP8m
CyRFP1
UseAAV and Cre/LoxExpressionMammalianPromoterCAGAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#1
Plasmid#235250PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#2
Plasmid#235251PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable SinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only