We narrowed to 7,001 results for: crispr cas9 plasmids
-
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-DEN2
Plasmid#238020Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-ABE-TMV
Plasmid#238021Purposefor DNA-free adenine base editing in rice and wheat or other plantsDepositorInsertTadA8e-nSpCas9(D10A)
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIVT-A3A-DEN2
Plasmid#238019Purposefor DNA-free cytosine base editing in rice and wheat or other plantsDepositorInsertA3A-nSpCas9(D10A)-UGI
ExpressionPlantMutationD10A for SpCas9PromoterT7Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.13
Plasmid#246892PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP2 Nterm.DepositorInsertG3BP2 Nterm Guide RNA 1 (G3BP2 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
P532_POU4F2-p2A-tdTomato-p2A-Thy1.2
Plasmid#239102PurposeHuman donor plasmid for integration of p2A-h2b-EGFP into the 3' end of POU4F2 (aka BRN3B). This includes the donor casette and a U6 driven guide sequence to be used with Cas9.DepositorInsertPOU4F2 (POU4F2 Human)
UseDonor plasmid for integration into the human geno…Tagsp2A-tdTomato-p2A-Thy1.2ExpressionMammalianPromoterEndogenous POU4F2Available SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
scAAV-sgRNA-GFP
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-Hf-RfxCas13d-His
Plasmid#234480PurposePlasmid for bacterial expression and purification of High-fidelity RfxCas13d protein (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTags6xHisExpressionBacterialMutationChanged four alanine to valine in positions 134, …Available SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGH020_sgRNA_G418-GFP
Plasmid#85405Purposehu6 driven sgRNA vector with G418 and GFP selectable markersDepositorInsertG418 resistance and GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MKC86_HBA1(tEPOR-2A-YFP)
Plasmid#232405PurposeAAV production plasmid for tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at HBA1 locus using HBA1-sg4 gRNA. HBA1 UTRs flank full tEPOR-2A-YFP cassette. Homology arms mediate full HBA1 replacement.DepositorUseAAVExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
DBJS-p2.11
Plasmid#246891PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid encoding guide for G3BP1 Nterm.DepositorInsertG3BP1 Nterm Guide RNA 1 (G3BP1 Human)
ExpressionMammalianAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN-P2A-GFP-multi-gRNA
Plasmid#85756PurposeAll in one plasmid that expresses Csy4, S.pyogenes FokI-dCas9-NLS, and GFP. Also encodes for multiplexed gRNAs. Backbone derived from pSQT1601 (Addgene #53369).DepositorInsertsCsy4-T2A-SpRFN-P2A-GFP
gRNA
UseCRISPRTagsCsy4, Csy4 recognition sequence, FokI fusion via …ExpressionMammalianMutationD10A, H840APromoterCMV and U6Available SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEditC
Plasmid#207532PurposePlasmid for cytidine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertxylS (cured of BsaI-sites), Pm→CBE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-C-WPRE
Plasmid#176650PurposeExpresses C-terminus of PE2 in mammalian cellsDepositorInsertsC-terminus of PE2
Artificial SA
WPRE
bGH poly(A)
UseAAVTagsSV40 NLSExpressionMammalianPromoterNoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
TS-PE2-N
Plasmid#176649PurposeExpresses N-terminus of PE2 in mammalian cellsDepositorInsertsN-terminus of PE2
Artificial SD
UseAAVTagsSV40 NLSExpressionMammalianPromoterCMV and NoneAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Ca9-WPRE
Plasmid#87874PurposeTransfer plasmid for the production of lentiviral vectorsDepositorInsertspCas9
UseLentiviralTagsnlsMutationHuman codon-optimizedPromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only