We narrowed to 27,899 results for: RON
-
Plasmid#61572PurposeRecombinase-mediated cassette exchange in ES cells to insert the Flpo recombinase gene at the mouse Pvalb gene stop codonDepositorInsertPvalb-2A-Flpo
UseRecombinase-mediated cassette exchange using flp …Available SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-PCNA-HygroR
Plasmid#215064PurposeExpresses mCerulean-PCNA in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-bREACHes-EYFP
Plasmid#137146PurposeIntersectional viral expression of bREACHes-EYFP in cells expressing Cre AND NOT FlpDepositorInsertCon/Foff 2.0-bREACHes-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP
Plasmid#137150PurposeIntersectional viral expression of Arch3.3-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-Arch3.3-p2a-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2-mCherry
Plasmid#137143PurposeIntersectional viral expression of ChR2-mCherry in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2-mCherry
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationH134RPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
Snap25-LSL-2A-GFP targeting vector
Plasmid#61575PurposeTarget a Cre-dependent GFP expression cassette to the stop codon of the mouse Snap25 geneDepositorInsertSnap25-LSL-2A-GFP
UseCre/Lox and Mouse TargetingAvailable SinceFeb. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCerulean-PCNA-PuroR
Plasmid#215063PurposeExpresses mCerulean-PCNA in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65453PurposeCan be used to generate AAV virus that will express EGFP from the tetO promoter under intersectional control by Flp and Cre recombinasesDepositorHas ServiceAAV1InsertEGFP
UseAAVPromotertetOAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1595
Plasmid#121062PurposemKate2^SEC^BioTag::AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertmKate2^SEC^BioTag::AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, Biotin acceptor peptide (BioTag), C. eleg…ExpressionWormAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
mKO2-CDK4
Plasmid#215065PurposeExpresses mKO2-CDK4 in mammalian cells from a retroviral vector.DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2B-SMASh-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187949PurposeSMASh degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSMASh-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1592
Plasmid#121059PurposeGFP^SEC^BioTag::AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertGFP^SEC^BioTag::AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, Biotin acceptor peptide (BioTag), C. eleg…ExpressionWormAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_HH-HEK3 spacer-gRNA scaffold-EC73-5'-donor template-EC73-3'-HDV_pA_pCMV_EGFP-L138S-P2A-mCherry_pA
Plasmid#176460PurposeVector for expressing retron Ec73ncRNA-gRNA chimeric RNA (rgRNA) targeting HEK3 site driven by EF1alpha promoter and EGFP(L138S)-P2A-mCherry driven by CMVDepositorInsertHH-HEK3 spacer-gRNA scaffold-Ec73ncRNA-donor sequence-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1594
Plasmid#121061PurposeTagRFP-T^SEC^BioTag::AID*::3xFLAG vector with ccdB sites for cloning homology arms.DepositorInsertTagRFP-T^SEC^BioTag::AID*::3xFlag
UseCRISPR and Cre/LoxTags3xFLAG, Biotin acceptor peptide (BioTag), C. eleg…ExpressionWormAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP-Tag5-IgKsp-mHevin∆DE-Myc-His
Plasmid#249177PurposeOverexpression of mouse Sparcl1 with deletion of a.a. 330-550 with Myc and 6xHis tagDepositorInsertSparcl1 (Sparcl1 Mouse)
Tags6xHis and MycExpressionMammalianMutationDeleted amino acids 330–550Available SinceJan. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GfaABC1D-mDE-Myc-His
Plasmid#249180PurposeAAV mediated overexpression of mouse Sparcl1 a.a. 330-550 fragmentDepositorInsertSparcl1 (Sparcl1 Mouse)
UseAAVTags6xHis and MycExpressionMammalianMutationamino acids 330–550Available SinceJan. 16, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Isl1-T2A-mLhx3
Plasmid#233160PurposeRetroviral expression of Isl1 and Lhx3 for motor neuron specificationDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only