We narrowed to 61,796 results for: promoter
-
Plasmid#171288PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertPTET-1x-repeat promoter+CPgpdA (fused)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFTK006
Plasmid#171278PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertPtef EF1-subunit ANIA_02063 promoter
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable sinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDSARN-vasa-eSpCas9sv40
Plasmid#173670PurposeeSpCas9 expression vector for AnophelesDepositorInserteSpCas9 with Anopheles vasa promoter and SV40 terminator
UseCRISPRExpressionInsectMutationmutations in Cas9 reducing off-target activity (S…PromotervasaAvailable sinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
YSEHPTFTSQY_epitope
Plasmid#165016PurposeExpression of CMV UL83 (363-373) fused to IL-2 signal sequenceDepositorInsertCMV UL83 (363-373)
UseLentiviralTagshuman IL2 signal sequence at N-termExpressionMammalianPromoterCMVAvailable sinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
1025
Plasmid#160235PurposeFlightN-TetR(OFF)-VP16-Sv40-attBDepositorInsertsTetracycline repressor
Flightin promoter
TagsVP16ExpressionInsectAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
907K
Plasmid#160236PurposeFlightN-PipR-VP16-Sv40-attBDepositorInsertspristinamycin repressor
Flightin promoter
TagsVP16ExpressionInsectAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer7
Plasmid#138579PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17918617_17920400DepositorAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.24-Cd36-enhancer6
Plasmid#138578PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17898458_17899478DepositorAvailable sinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer3
Plasmid#138575PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17848003_17849903DepositorAvailable sinceMay 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.24-Cd36-enhancer5
Plasmid#138577PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17893352_17894696DepositorAvailable sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.24-Cd36-enhancer2
Plasmid#138574PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17843052_17844983DepositorAvailable sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGM28521
Plasmid#105359PurposeSynthetic biologyDepositorInsertEC1.2en-EC1.1p fusion promoter
UseSynthetic BiologyMutationBsaI/ BpiI restriction sites removedAvailable sinceAug. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICSL11058
Plasmid#68254PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barleyDepositorInsertPromoter_TaU6 + sgRNA_HvPM19_3
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-d2eGFP-20pf
Plasmid#21971DepositorPublicationInsertCMV d2eGFP miR-20 perfect
ExpressionMammalianAvailable sinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
907H1
Plasmid#160234PurposeFlightN-CymR-VP16-3X-SV40-attBDepositorInsertsp-cymene repressor
Flightin promoter
TagsVP16ExpressionInsectAvailable sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
U6b
Plasmid#117222PurposeExpresses gRNA in Aedes aegyptiDepositorInsertHR U6b promoter-gRNA
UseSynthetic BiologyExpressionInsectPromoterU6Available sinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJH124
Plasmid#48259PurposeTemplate plasmid for PCR-based transplant of Ashbya gossypii TEF1 promoter in yeast.DepositorInsertsURA3 3' fragment
URA3 5' fragment
Ag TEF1 promoter
UseRoutine cloning vectorMutation-242 upstream to URA3 ORF +495 and URA3 ORF from …PromoterAg TEF1 promoterAvailable sinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CB-IRES-copGFP-T2A-Puro
Plasmid#72299PurposeExpress gene of interest under CB promoterDepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterchicken beta-actin + CMV enhancerAvailable sinceJan. 25, 2016AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by