We narrowed to 20,753 results for: 110
-
Plasmid#110234PurposeCre/Lox C-terminal tagging construct encoding single copy of the FLAG epitopeDepositorTypeEmpty backboneUseCre/LoxAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAW8_Xho
Plasmid#110223PurposeCre-expression plasmid for cassette exchange but MCS modified compared to pAW8DepositorTypeEmpty backboneUseCre/LoxAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDB367
Plasmid#110277PurposegHEEE_02 with a N-terminal 10-His DsbC TEV-peptide fusionDepositorInsertgHEEE_02
Tags10-His, Tev recognition peptide, and mature DsbC …ExpressionBacterialPromoterT7Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
F. prausnitzii mRNA toehold switch sensor
Plasmid#110716PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertF. prausnitzii species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
C. difficile mRNA toehold switch sensor
Plasmid#110714PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertC. difficile species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
R. hominis mRNA species specific sensor
Plasmid#110713PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertR. hominis species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
E. rectale mRNA toehold switch sensor
Plasmid#110712PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertE. rectale species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. breve mRNA toehold switch sensor
Plasmid#110711PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. breve species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. longum mRNA toehold switch sensor
Plasmid#110709PurposeToehold switch sensor to detect a species specific mRNA with GFP outputDepositorInsertB. longum species specific toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
F. prausnitzii 16S toehold switch sensor
Plasmid#110705PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertF. prausnitzii 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
R. hominis 16S toehold switch sensor
Plasmid#110703PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertR. hominis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
E. rectale 16S toehold switch sensor
Plasmid#110702PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertE. rectale 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. breve 16S toehold switch sensor
Plasmid#110701PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. breve 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. adolescentis 16S toehold switch sensor
Plasmid#110700PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. adolescentis 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. longum 16S toehold switch sensor
Plasmid#110699PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. longum 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
B. thetaiotaomicron 16S toehold switch sensor
Plasmid#110697PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP outputDepositorInsertB. thetaiotaomicron 16S toehold switch sensor
UseSynthetic BiologyPromoterT7Available SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_TAP
Plasmid#110240PurposeCre/Lox C-terminal tagging construct encoding the Twin Affinity Purification proteinDepositorTypeEmpty backboneUseCre/LoxAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAW8_3HA
Plasmid#110233PurposeCre/Lox C-terminal tagging construct encoding 3 copies of the influenza virus hemagglutunin (HA) epitopeDepositorTypeEmpty backboneUseCre/LoxAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
Met1 diUb (1-152, R42W)
Plasmid#110767PurposeBacterial expression of Met1 diUbDepositorAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only