We narrowed to 903 results for: tdTomato
-
Plasmid#34630PurposeCre-dependent expression of hChR2(H134R)-tdTomato, for optogenetic excitationDepositorInsertFloxed hChR2(H134R)-tdTomato
UseMouse TargetingTagstdTomatoMutationHis 134 has been mutated to ArgPromoterCAGAvailable SinceFeb. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
ptdTHC_PGKneoLox2DTA.2
Plasmid#112625PurposeH2BtdTomato_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagstdTomatoPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
TOPO mMecp2-NLucTom
Plasmid#159282PurposeTo tag endogenously and c-terminally mouse Mecp2 with two reporters: NanoLuciferase and TdTomato. It contains 2 homology arms from a castaneus background surrounding the STOP codon.DepositorInsertMecp2 (Mecp2 Mouse)
TagsNluciferase-P2A-TdTomatoExpressionMammalianMutationNluciferase-TdTomato fusionAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCITF-KCC2
Plasmid#61404PurposeMammalian expression vector for human KCC2 under CAG promoter. Coexpression of TdTomato with IRES sequenceDepositorAvailable SinceAug. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Tm2AG
Plasmid#26773DepositorInsertTdTomato-2A-H2BGFP-SV40pA
ExpressionMammalianMutationmutation in 2A peptide that renders it non-functi…Available SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJAT71
Plasmid#204305PurposeExpresses jGCaMP7s-T2A-tdTomato under UAS control. HDR event marked with removable ie1XP3-DsRed cassette expressed in abdomen and mouthparts.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-NM
Plasmid#48679PurposeMammalian tdTomato activation reporter for NM with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pART (pT-2)
Plasmid#62708PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
M-tdTom-ST1
Plasmid#48678PurposeMammalian tdTomato activation reporter for ST1 with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
UseCRISPRPromoterSp6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJDC122
Plasmid#157876PurposetdTomato is expressed under the mycobacterial phsp60 heat shock promoter for in vivo and in vitro detection.DepositorInserttdTomato
ExpressionBacterialAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
RV-Cag-Dio-mTdt
Plasmid#87665Purposeretroviral vector encoding cre dependent expression of membrane TdtomatoDepositorInsertMem-Tdtomato
UseRetroviralPromoterCAGAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAQI (pT-1)
Plasmid#62707PurposeMammalian expression of tdTomato from the broadly active CAG promoter/enhancerDepositorInserttdTomato
ExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
RV-Syn-Dio-mTdt
Plasmid#87667Purposeretroviral vector encoding cre dependent expression of membrane TdtomatoDepositorInsertMem-Tdtomato
UseRetroviralTagspalmitylationPromoterSynapsinAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJAT58
Plasmid#204304PurposeExpresses jGCaMP7s-T2A-tdTomato under UAS control. HDR event marked with removable 3XP3-DsRed cassette expressed in eyes.DepositorInsert3XP3-DsRed
UseCRISPRPromoter3XP3Available SinceAug. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pO5
Plasmid#193749PurposeExpresses tdTomato under the control of PIAH synthetic promoter regulated by AHL and IPTG, p15A origin of replication, Chloramphenicol selectionDepositorInserttdTomato
ExpressionBacterialPromoterPIAHAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pARA (pKD-G1)
Plasmid#62680PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARB (pKD-G2)
Plasmid#62681PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB116
Plasmid#68570PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsNuclear localization signal-tagged tdTomato (tdTo…ExpressionPlantAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
INS-2A-luciferase-2A-tdT
Plasmid#159348PurposeHuman INS targeting vector for knockin of 2A separated luciferase and tdTomato. Targeted cells will be puromycin resistant.DepositorInsertLuciferase-2A-tdTomato
UseIns locus knockin donor vectorAvailable SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only