We narrowed to 42,296 results for: lat
-
Plasmid#209786PurposeExpresses TadA8e and SpRY cas9N by the specific TNT4 promoterDepositorInsertTNT4, TadA8e, SpRY N, inteinN
UseAAVPromoterTNT4Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-SRRD-V5-APEX2 (in pLEX_307)
Plasmid#214921Purposeconstitutive expression of SRRD fused to V5 and APEX2 - used for APEX2 proximity biotinylationDepositorAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II Ks(+)-ZsGreen1-SV40 PolyA-Stop Mettl3 HDR
Plasmid#207136PurposeDNA sequence source for amplifying an HDR template for mouse Mettl3 knockout and reporter knock-inDepositorInsert5'HDR Mettl3 - ZsGreen- sv40(polyA) - 3'HDR Mettl3 (Mettl3 Mouse)
ExpressionMammalianAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-Nedd1-mOrange2
Plasmid#196860PurposeExpression of neural precursor cell expressed developmentally down-regulated 1 (Nedd1) fused to mOrange2DepositorInsertNedd1-mOrange2 (Nedd1 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-V5His6_H
Plasmid#146499PurposeInsect Expression of DmGW182DepositorInsertDmGW182 (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS2326
Plasmid#169628PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and pGL3-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2321
Plasmid#169626PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and CoTC-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2322
Plasmid#169627PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' Tactb insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::Tactb-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and Tactb-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2312
Plasmid#169622PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' CoTC insulator sequence (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::CoTC-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and CoTC-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2317
Plasmid#169624PurposeTier-2 co-expression vector encoding PhCMV-driven SEAP coupled to fluorescent reporter iRFP670 and PmPGK1-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 that is insulated via a 5' insulator sequence derived from the pGL3 plasmid (PhCMV-SEAP-p2A-iRFP670-pA::A2-pA::pGL3-PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPCMV-driven expression of SEAP and iRFP and pGL3-modulated PPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPhCMV / PPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-col2a1a-KI-donor
Plasmid#184876PurposeDonor template for knock-in of p2a-CreERT2 into the medaka col2a1a locus via CRISPR/Cas9-mediated homology directed repairDepositorInsertsCollagen2a1a 5' homology arm
Collagen2a1a 3' homology arm
p2a-CreERT2
Myosin light chain 2 promoter
EGFP
UseCRISPR and Cre/LoxAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+Q111R
Plasmid#167173PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with Q111R mutation in Sf9 cellsDepositorInsertsATP1A1-S+Q111R
ATP1B1
ExpressionBacterial and InsectMutationChanged Q at 111 to RPromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
S+N122D
Plasmid#167174PurposeExpresses the full Leptodactylus latrans Na+K+ATPase with ATP1A1-S variant with N122D mutation in Sf9 cellsDepositorInsertsATP1A1-S+N122D
ATP1B1
ExpressionBacterial and InsectMutationChanged N at 111 to DPromoterP10 and PHAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSUMO His6 SUMO SnRK2.3 (19-361)
Plasmid#177846PurposeBacterial Expression of SnRK2.3DepositorAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1B-mCherry-StreptagII
Plasmid#158744PurposeExpresses K2P4.1 isoform B with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-B (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-290 and N-linked glycosylation sites r…PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15A
Plasmid#113011PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)DepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-beta2(616-951)Double
Plasmid#100746PurposeBacterial expression of GST-tagged beta2 subunit of AP2 complex (hinge and ear) long splice form, mutantDepositorInsertAP2B1 (AP2B1 Human)
TagsGSTExpressionBacterialMutationLong isoform with deletion of clathrin binding mo…Available SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only