We narrowed to 7,512 results for: mcherry
-
Plasmid#195132PurposegRNA from the Weissman CRISPRi library targeting MDM4, cloned into a third generation gRNA backbone with mCherryDepositorInsertMDM4 CRISPRi gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR328-3p
Plasmid#153319PurposeExpresses zsGreen fused to a miR-328-3p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR328-3p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-anti-MIR211-5p
Plasmid#153318PurposeExpresses zsGreen fused to a miR-211-5p sponge and mCherry in mammalian cells.DepositorInsertzsGreen with MIR211-5p sponge
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry (AAV PHP.eB)
Viral prep#213915-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiLAMP5e3_ChR2_mCherry (#213915). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 HITI-2c ACTB
Plasmid#206269PurposeENTR Vector 1 for MultiSite Gateway assembly. Encodes HITI-2c donor for ACTB C-terminal tagging (mCherry T2A Puro) in human cellsDepositorInsertHITI-2c donor
UseCRISPR; Multimate/gateway entr 1ExpressionMammalianAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Downstream_gRNA_2
Plasmid#195137PurposegRNA in a third generation gRNA backbone with mCherry, targeting region immediately downstream of MDM4, to be used with MDM4_Deletion_Upstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Downstream gRNA 2 (MDM4 Human)
ExpressionMammalianAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
MDM4_Deletion_Downstream_gRNA_1
Plasmid#195136PurposegRNA in a third generation gRNA backbone with mCherry, targeting region immediately downstream of MDM4, to be used with MDM4_Deletion_Upstream_gRNA_1/2 for MDM4 deletionDepositorInsertMDM4 Deletion Downstream gRNA 1 (MDM4 Human)
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe10_ChR2_mCherry (AAV1)
Viral prep#213815-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiSSTe10_ChR2_mCherry (#213815). In addition to the viral particles, you will also receive purified pAAV_BiSSTe10_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the SST interneuron-targeting enhancer E10. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAT15535_hU6_epegRNA_Ef1a-mCh
Plasmid#251104PurposeepegRNA cloning plasmid + mCherry expressionDepositorInsertpegRNA cloning vector
UseCRISPRAvailable sinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.1
Plasmid#227945PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgCdkn1a.2
Plasmid#227946PurposesgRNA targeting Cdkn1a, mCherry, puromycin resistance, Mammalian expression, Mouse targeting, lentiviral, CRISPRDepositorAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V1
Plasmid#222498PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V1 (R887E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V1 (R887E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; R887E in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EFS-SpdCas9-Dnmt3A/3L-V2
Plasmid#222499PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant V2 (E814G) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant V2 (E814G) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; E814G in Dnmt3APromoterEFSAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (NEDD4-2 WW2 domain)
Pooled library#111708PurposeEncodes NEDD4-2 WW2 domain and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (NEDD4 WW2 domain)
Pooled library#111707PurposeEncodes NEDD4 WW2 domain and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (14-3-3σ)
Pooled library#111706PurposeEncodes 14-3-3σ and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Mode #2 Library (14-3-3β)
Pooled library#111705PurposeEncodes 14-3-3β and human phosphopeptides fused to split mCherry for Hi-PDepositorExpressionBacterialSpeciesHomo sapiensAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable sinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry (AAV1)
Viral prep#213915-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiLAMP5e3_ChR2_mCherry (#213915). In addition to the viral particles, you will also receive purified pAAV_BiLAMP5e3_ChR2_mCherry plasmid DNA. Expression of mCherry-tagged channelrhodopsin-2 under the control of the Lamp5 interneuron-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorTagsmCherryAvailable sinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only