We narrowed to 25,303 results for: ung
-
Viral Prep#137143-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Foff 2.0-ChR2-mCherry (#137143). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Foff 2.0-ChR2-mCherry plasmid DNA. nEF-driven, Cre-dependent expression of ChR2-mCherry for optogenetic activation (inhibited in the presence of Flp recombinase). These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsmCherry (Cre-dependent)Available SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP (AAV8)
Viral Prep#137148-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP (#137148). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon-Arch3.3-p2a-EYFP plasmid DNA. nEF-driven, Cre and Flp-dependent expression of Arch3.3-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre and Flp-dependent)Available SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Archon1-KGC-GFP-ER2 (AAV8)
Viral Prep#115892-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-Archon1-KGC-GFP-ER2 (#115892). In addition to the viral particles, you will also receive purified pAAV-Syn-Archon1-KGC-GFP-ER2 plasmid DNA. Syn-driven Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP (AAV8)
Viral Prep#137150-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP (#137150). In addition to the viral particles, you will also receive purified pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP plasmid DNA. nEF-driven, Flp-dependent expression of Arch3.3-EYFP (inhibited in presence of Cre) for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Flp-dependent)Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (AAV8)
Viral Prep#137140-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP (#137140). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP plasmid DNA. nEF-driven, Cre-dependent expression of ChR2(E123T/T159C)-EYFP (inhibited in presence of Flp) for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre-dependent)Available SinceMay 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (AAV8)
Viral Prep#115893-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] (#115893). In addition to the viral particles, you will also receive purified pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] plasmid DNA. Syn-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFP (Cre-dependent)Available SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon/Von eYFP (AAV Retrograde)
Viral Prep#137164-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-nEF-Con/Fon/Von eYFP (#137164). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon/Von eYFP plasmid DNA. nEF-driven, Cre, Flp and VCre-dependent expression of EYFP. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsEYFP (Cre, Flp and VCre-dependent)Available SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)
Plasmid#217340PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N MCV ER
Plasmid#37860DepositorUseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (AAV Retrograde)
Viral Prep#84445-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (#84445). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] plasmid DNA. CAG-drive, Cre-dependent Jaws-GFP for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFP (Cre-dependent)Available SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (AAV5)
Viral Prep#108422-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 (#108422). In addition to the viral particles, you will also receive purified pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 plasmid DNA. CAG-driven, Cre dependent Archon1, an opsin-based fluorescent voltage indicator, fused to EGFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsEGFP (Cre-dependent)Available SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
FB027
Plasmid#119712PurposeMultipartite assembly obtained by combining FB parts FB026+FB003 into pDGB3omega1. Used for fluorescent tagging of fungi (Hyg resistance +YFP) according to FungalBraid modular DNA assembly for ATMTDepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC::hph::Ttub (→)
UseSynthetic BiologyAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB012
Plasmid#119709PurposeComplete TU for hygromicin resistance in fungi, domesticated into pUPD2 with AATG/GCTT barcodes. Used for gene KO with dual selection, according to FungalBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic Biology; Domestication of dna parts for…Available SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB039
Plasmid#119715PurposeMultipartite assembly obtained by combining FBparts FB026+FB009 into pDGB3omega1. Used for fluorescent tagging of fungi (G418 resistance + YFP), according to FungalBraid modular DNA assembly for ATMT.DepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC:nptII::Ttub (→)
UseSynthetic BiologyAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB010
Plasmid#119708PurposeTranscriptional Unit (TU) for hygromicin resistance in fungi obtained by combining FB001+GB0211+FB002 into pDGB3alpha1. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic BiologyAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
FB003
Plasmid#119677PurposeTranscriptional Unit (TU) for hygromicin resistance in fungi obtained by combining FB001+GB0211+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic BiologyAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB009
Plasmid#119707PurposeTranscriptional Unit (TU) for geneticin (G418) resistance in fungi obtained by combining FB001+FB005+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC::nptII::Ttub
UseSynthetic BiologyAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
MLM3636
Plasmid#43860Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence, uses U6 promoterDepositorInsertNone
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only