We narrowed to 13,933 results for: ckb
-
Plasmid#41827PurposeUsed as a PCR template for tagging yeast proteins with the DHFR tag (c-terminal histag) by homologous recombination and selection for phleomycin resistance.DepositorTypeEmpty backboneUsePcr templateExpressionYeastPromoterTEFAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pGGH000
Plasmid#48862PurposeEmpty entry vector for creating GreenGate N-terminal tag + coding sequence + C-terminal tag + terminator modules.DepositorTypeEmpty backboneUseGolden gate compatible cloning vectorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLUK
Plasmid#64184Purposeharbours marker genes LEU2, URA3 and LYS2DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAL-3TA4
Plasmid#41472DepositorInsert3TA4
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHU
Plasmid#64172Purposeharbours marker genes HIS3 and URA3DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLM
Plasmid#64175Purposeharbours marker genes LEU2 and MET17DepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceAug. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFGL889
Plasmid#52321PurposeIntroducing ectopic integration at the defined fungal ILV2-locus, based on SRR (Sulfonylurea Resistance Reconstitution).DepositorTypeEmpty backboneUseAgrobacteriumExpressionBacterialAvailable SinceJuly 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGDHFR
Plasmid#63956PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term non-cleavable single tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTagsFLAGExpressionBacterialPromoterT7Available SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pST50Trc2-FLAGHISNDHFR
Plasmid#63965PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & FLAG; TEV cleavableExpressionBacterialPromoterT7Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-cyEGFP
Plasmid#48988Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-8XDSR
Plasmid#48981Purposefor Cre-lox cassette exchange of untagged gene sequences together with 8 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-c3HA
Plasmid#48989Purposefor Cre-lox cassette exchange of C-terminal 3XHA tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTags3XHA tagAvailable SinceDec. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-3XDSR
Plasmid#48976Purposefor Cre-lox cassette exchange of untagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TAL-4GA1
Plasmid#41504DepositorInsert4GA1
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRET.IIS.IRES-EGFP
Plasmid#1838DepositorTypeEmpty backboneUseCre/Lox and RetroviralExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
pART7
Plasmid#247985PurposeCloning vector to transiently express an inserted gene in plant cells under the control of the 35S CaMV promoter.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDASH-DIS-α2 (MoClo)
Plasmid#242524PurposeDonor I vector in DASH and alpha2 vector in GoldenBraid/DASH, with SacB counter-selection, compatible with MoClo, with attBTT and attBCC-FRTDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLFYa
Plasmid#243803PurposeDropout vector for genomic integration into yeast strain LFYa. GFP is flanked by BamHI sites for easy cloning using Gibson assembly. Construct contains the attP site for the serine recombinase BxB1.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLFYalpha
Plasmid#243804PurposeDropout vector for genomic integration into yeast strain LFYalpha. GFP is flanked by BamHI sites for easy cloning using Gibson assembly. Construct contains attB site for the serine recombinase BxB1.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only