We narrowed to 12,063 results for: ARIA;
-
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
TagsHAExpressionPlantPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#1
Plasmid#197421PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #1 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#2
Plasmid#197422PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #2 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-mCherry_MAPRE3-gRNA#3
Plasmid#197423PurposeKnock out of EB3 in human cells by CRISPR/Cas9DepositorInsertMAPRE3 gRNA #3 (targets Exon 1) (MAPRE3 Human)
UseCRISPRAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-In18runon-PTPN22
Plasmid#195377PurposeA human PTPN22 mutant (intron 18-runon) in Gateway pDONR221DepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-In18runon-PTPN22
Plasmid#195379PurposeMammalian expression of a human PTPN22 mutant (intron 18-runon) with FLAG tagDepositorAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
FLAG-Ex1-17-PTPN22
Plasmid#195375PurposeMammalian expression of a human PTPN22 mutant (exon 1-17) with FLAG tagDepositorInsertPTPN22 (PTPN22 Human)
TagsFLAGExpressionMammalianMutationPTPN22 mutant containing exon 1 to 17Available SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGADT7-γ1
Plasmid#197078PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 γ1 fusion protein in yeast (yeast two-hybrid or yeast three-hybrid assays)DepositorInsertAP-1 γ1 (Ap1g1 Mouse)
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2
Plasmid#185346PurposeMembrane anchoring of UBE2G2. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2DepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
ExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Cue1pTM-MYC-UBE2G2-FLAG
Plasmid#185347PurposeMembrane anchoring of UBE2G2 and co-IP. Encodes transmembrane domain of S. Cerevisiae Cue1p fused to MYC-UBE2G2 with C-terminal FLAG tagDepositorInsertCue1p/Ube2G2 fusion (internal MYC tag)
TagsFLAGExpressionMammalianAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
P2061
Plasmid#186299PurposeExpresses LexA-HBD-B112 under the control of pAct1 and Cas9 under the control of LexA-HBD-B112+Beta-estradiol inducible promoterDepositorInsertsLexA-HBD-B112
Cas9
UseCRISPR and Synthetic BiologyExpressionBacterial and YeastPromoter2xLexop-minimalCyc1 and PACT1Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-NTEV-TCS-GV-2xHA
Plasmid#194371PurposeSplit TEV assaysDepositorInsertSP-AVPR2-NTEV-TCS-GV-2xHA (AVPR2 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GLP1R-NTEV-TCS-GV-2xHA
Plasmid#194379PurposeSplit TEV assaysDepositorInsertSP-GLP1R-NTEV-TCS-GV-2xHA (GLP1R Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-NTEV-TCS-GV-2xHA
Plasmid#194359PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194360PurposeSplit TEV assaysDepositorInsertDRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Human, Synthetic)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD2-NTEV-TCS-GV-2xHA
Plasmid#194362PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only