We narrowed to 22,830 results for: Ide

#81879

Gateway Donor vector containing FTH1 , part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#81773

Gateway Donor vector containing KIR3DL2 , part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#81664

Gateway Donor vector containing NRAS, part of the Target Accelerator Plasmid Collection.

Jesse Boehm, William Hahn, David Root

Kim et al Cancer Discov. 2016 Jul;6(7):714-26. doi

April 24, 2017

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#73127

EXPRESs plasmid for human erythrocyte surface proteins encoding MET7A with rat CD4d3+4-bio

Gavin Wright

Crosnier et al Nature. 2011 Nov 9;480(7378):534-7. doi:

March 29, 2016

Academic Institutions and Nonprofits only

#73126

EXPRESs plasmid for human erythrocyte surface proteins encoding C8orf55 with rat CD4d3+4-bio

Gavin Wright

Crosnier et al Nature. 2011 Nov 9;480(7378):534-7. doi:

March 29, 2016

Academic Institutions and Nonprofits only

#73112

EXPRESs plasmid for human erythrocyte surface proteins encoding PGRMC2 with rat CD4d3+4-bio

Gavin Wright

Crosnier et al Nature. 2011 Nov 9;480(7378):534-7. doi:

March 28, 2016

Academic Institutions and Nonprofits only

#73091

EXPRESs plasmid for human erythrocyte surface proteins encoding APMAP with bio-rat CD4d3+4

Gavin Wright

Crosnier et al Nature. 2011 Nov 9;480(7378):534-7. doi:

March 28, 2016

Academic Institutions and Nonprofits only

#64999

Expression of cytosolic Grx1-roGFP2 under the alphaTub84B promoter

Tobias Dick

Albrecht et al Cell Metab. 2011 Dec 7;14(6):819-29. doi

July 8, 2015

Academic Institutions and Nonprofits only

#64232

Expresses miR-30b in mammalian cells

Joshua Mendell

Chang et al Nat Genet. 2008 Jan;40(1):43-50. Epub 20

June 2, 2015

Academic Institutions and Nonprofits only