We narrowed to 9,379 results for: mel
-
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pInducer 21-3xFlag-hMEFV-ΔPLD
Plasmid#195479PurposepInducer21 plasmid containing the human MEFV gene with a deletion of residues 88 - 310 (the resulting pyrin protein lacks the Phosphorylated Linker Domain domain) with a 3xFlag tag at the N-terminusDepositorInsertMEFV (MEFV Human)
UseLentiviralTags3xFlagExpressionMammalianMutationdeletion of residues 88 - 310 (the resulting pyri…Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGG_Sr1644-1Sh
Plasmid#164087PurposeExpresses pGGG_Sr1644-1Sh in plantsDepositorInsertpGGG_Sr-1644-1Sh
TagsnoneExpressionBacterial and PlantPromoterNative promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-PuroR [M1G]
Plasmid#171803PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-Ova-BlastR [M1G]
Plasmid#171817PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-BlastR [M1G]
Plasmid#171816PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.DepositorInsertmScarlet-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-hgp100-BlastR [M1G]
Plasmid#171815PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmScarlet-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-gB-PuroR [M1G]
Plasmid#171812PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and puromycin resistance cassette [p.M1DepositorInsertmScarlet-F-gB-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mScarlet-F-mgp100-PuroR [M1G]
Plasmid#171811PurposeUniversal donor plasmid for CRISPitope method encoding mScarlet fluorescent protein, FLAG tag, murine gp100 CD8+ T cell epitope [AA: 25-33 (EGSRNQDWL)] and puromycin resistance cassette [p.M1G]DepositorInsertmScarlet-F-mgp100-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-BlastR [M1G]
Plasmid#171808PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-Ova-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-gB-BlastR [M1G]
Plasmid#171807PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, HSV-1 glycoprotein B CD8+ T cell epitope [AA: 498-505 (SSIEFARL)] and blasticidin resistance cassette [p.M1GDepositorInsertmNeonGreen-F-gB-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-hgp100-BlastR [M1G]
Plasmid#171806PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, human gp100 CD8+ T cell epitope [AA: 25-33 (KVPRNQDWL)] and blasticidin resistance cassette [p.M1G]DepositorInsertmNeonGreen-F-hgp100-T2A-BlastR
UseGene taggingMutationBlastR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-mNeon-F-Ova-PuroR [M1G]
Plasmid#171804PurposeUniversal donor plasmid for CRISPitope method encoding mNeon fluorescent protein, FLAG tag, Ovalbumin CD8+ T cell epitope [AA: 257-264 (SIINFEKL)] and puromycin resistance cassette [p.M1G]DepositorInsertmNeonGreen-FLAG-Ova-T2A-PuroR
UseGene taggingMutationPuroR: Changed Methionin 1 to Glycine.Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CD74-ROS1 nonmutant
Plasmid#183813PurposeExpress CD74-ROS1 fusion (C6;R34) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of CD74 exon 1-6 and ROS1 exon…ExpressionMammalianPromoterCMVAvailable SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWZL Sox2
Plasmid#26351DepositorAvailable SinceSept. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
P3-dCas9-Tet1-GFP-Puro
Plasmid#190728PurposeExpression of human spdCas9-Tet1 fusion for targeted DNA methylation in mammalian cell. EGFP-puromycin double marker under an independent CMV promoter. Cloning backbone for spgRNA (BbsI)DepositorInsertdCas9-tet1
UseCRISPRTags3XFLAG and SV40 NLSExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterpCAGAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only