We narrowed to 82,938 results for: MYC;
-
Plasmid#175802PurposePlasmid for overexpression of recombinant His-tagged protein DspB(E184Q), used as a probe for binding to biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsHexahistidine tagExpressionBacterialMutationE184QPromoterT7Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBJ4
Plasmid#167133PurposeA kanamycin resistant plasmid for Tn7-mediated chromosomal integration of Photorhabdus luminescens luxCDABE operon with Pkan promoterDepositorInsertluxCDABE
UseLuciferaseExpressionBacterialPromoterKanamycin promoterAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRCC-K
Plasmid#81191PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable SinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLPCX roGFP2-Orp1
Plasmid#64991PurposeMammalian expression of cytosolic roGFP2-Orp1 (retroviral vector)DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pME-QFGal4-SV40pA
Plasmid#155118PurposeMiddle entry vector containing QFGal4DepositorInsertQFGal4
UseGateway middle entry vectorAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioD
Plasmid#65350Purposesysthesis of vioD gene in the violacein pathwayDepositorInsertvioD
UseSynthetic BiologyAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKMV-VioC
Plasmid#65349Purposesysthesis of vioC gene in the violacein pathwayDepositorInsertvioC
UseSynthetic BiologyAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMpGE013
Plasmid#108681PurposeAll-in-one genome editing vector in M. polymorpha (hygromycin resistant)DepositorTypeEmpty backboneUseCRISPRAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMT85_PS-mEos3.2_GentaR
Plasmid#173895PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the Spiralin promoterDepositorInsertmEos3.2
ExpressionBacterialPromoterSpiralinAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-FRT-KanR-FRT pA
Plasmid#82601Purpose3' entry vector containing FRT-flanked kanamycin resistance cassette (KanR) with pA for FLP-induced kanamycin resistance, drug selectionDepositorInsertFRT-Kan-FRT
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pGH335_MS2-AID*Δ-Hygro
Plasmid#85406Purposelentiviral expression vector for MS2-AID*Δ fusion protein with hygromycin B selectable markerDepositorInsertMS2-AID*Δ and Hygromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGilesSHdI_redgreen_2395A_His6_triple red_pLeft1806_His6_double green
Plasmid#170048PurposeTri-Responsive Reporter Gene Construct for redgreen, triple red, and double greenDepositorInsertsmScarlet
COmScarlet
mRuby3
mWasabi dN
mWasabi CO
UseUnspecifiedAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPCX mito roGFP2-Orp1
Plasmid#64992PurposeMammalian expression of mitochondrial roGFP2-Orp1 (retroviral vector)DepositorInsertOrp1 (HYR1 Budding Yeast)
UseRetroviralTagsroGFP2ExpressionMammalianMutationmitochondrial targeting sequenceAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFGL1252_TetGFP(Hyg)
Plasmid#118993PurposeTetOFF controlled GFP-tagging vector with Hygromycin selectionDepositorInserteGFP
UseFungal expression (in magnaporthe oryzae)PromoterUstilago maydis Mfa1 basal promoter with six tetO…Available SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT51
Plasmid#223423PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for dicot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-RRV-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28a (+)-Gal4-vp16
Plasmid#171075PurposeExpresses Gal4-vp16 fusion protein in bacteriaDepositorInsertGal4 DBD (NEWENTRY Budding Yeast)
TagsHis and VP16 AD (413-490)ExpressionBacterialPromoterT7 promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only