We narrowed to 7,771 results for: Pol
-
Plasmid#152118PurposeMammalian expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHis-003ExpressionMammalianMutationwtPromoterCMVAvailable sinceMay 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4134066
Plasmid#152094PurposeMammalian expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;S-tagExpressionMammalianMutationwtPromoterCMVAvailable sinceMay 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4134303
Plasmid#152065PurposeMammalian expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;CBPExpressionMammalianMutationwtPromoterCMVAvailable sinceMay 20, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGBW-m4046241
Plasmid#148997PurposeYeast Expression plasmid for SARS-CoV-2 RNA-dependent RNA polymeraseDepositorInsertSARS-CoV-2 RNA-dependent RNA polymerase (ORF1ab Severe acute respiratory syndrome coronavirus 2)
TagsCleavable thrombin;MBPExpressionYeastMutationwtPromoterpTEF1Available sinceMay 14, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
HA tagged Xba ELL2
Plasmid#127268PurposeFor in vitro translation of WT ELL2 with HA tag inserted near N-termDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationELL2mRNA+polyA with HA tag inserted at aa12 betwe…PromoterT7Available sinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pK RagA(R37P)-RagC
Plasmid#99706PurposeBacterial expression of RagA(R37P)-RagCDepositorTagsHis tag, Poly Arg, and SUMOExpressionBacterialMutationR37PPromoterT7Available sinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pK RagA-RagC(L91P)
Plasmid#99707PurposeBacterial expression of RagA-RagC(L91P)DepositorTagsHis tag, Poly Arg, and SUMOExpressionBacterialMutationL91PPromoterT7Available sinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pK RagA-RagC(K84T)
Plasmid#99708PurposeBacterial expression of RagA-RagC(K84T)DepositorTagsHis tag, Poly Arg, and SUMOExpressionBacterialMutationK84TPromoterT7Available sinceNov. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGS-3R112C/T180C
Plasmid#85095PurposeHost vector to fuse a gene at the N-terminus of PCNA3 variant (R112C/T180C)DepositorInsertDNA polymerase sliding clamp 3
TagsHis6 tagExpressionBacterialMutationchanged Arginine 112 to Cysteine and Threonine 18…PromoterT7 promoterAvailable sinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGWB418
Plasmid#68683PurposeGateway binary vector designed for transgenic research with Marchantia polymorpha as well as other plantsDepositorTypeEmpty backboneTagsModified EAR motif plant-specific repression doma…ExpressionPlantPromoterMpEF1alpha promoterAvailable sinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmCherry_C1 I3
Plasmid#61398PurposeExpresses mCherry-tagged Inhibitor-3 in mammalian cellsDepositorAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET15b+PCNA3 T180C
Plasmid#66181PurposeExpresses the T180C mutant of Sulfolobus solfataricus PCNA3DepositorInsertDNA polymerase sliding clamp 3
TagsHis6 tagExpressionBacterialMutationT180CPromoterT7 promoterAvailable sinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET15b+PCNA3 R112C
Plasmid#66180PurposeExpresses the R112C mutant of Sulfolobus solfataricus PCNA3DepositorInsertDNA polymerase sliding clamp 3
TagsHis6 tagExpressionBacterialMutationR112CPromoterT7 promoterAvailable sinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET15b+PCNA2 E105C
Plasmid#66176PurposeExpresses the E105C mutant of Sulfolobus solfataricus PCNA2DepositorInsertDNA polymerase sliding clamp 2
TagsHis6 tagExpressionBacterialMutationE105CPromoterT7 promoterAvailable sinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSlb-R756S
Plasmid#60730PurposeExpresses both fragments of T7 RNAP split at position 179. The N-terminal fragment is driven by PLac while the C-terminal fragment is driven by PBAD. C-terminal fragment has the point mutations R756SDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available sinceJan. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTSara-R756S
Plasmid#60725PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation R756S. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTSara-Q758C
Plasmid#60724PurposeExpresses both fragments of T7 RNAP split at position 179. Both fragments are driven by PBAD. The C-terminal fragment has the point mutation Q758C. Contains a constitutive araC ORFDepositorInsertsResidues 1-179 of split T7 RNAP
Residues 180-880 of split T7 RNAP
UseSynthetic BiologyExpressionBacterialMutationResidues 1-180 of split T7 RNAP and Residues 180-…Available sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
sugarless cDNA
Plasmid#42063DepositorInsertsugarless (sgl Fly)
Available sinceFeb. 21, 2013AvailabilityAcademic Institutions and Nonprofits only