We narrowed to 2,587 results for: pcas
-
Plasmid#82392PurposesgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas39
Plasmid#82389PurposesgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas36
Plasmid#82388PurposesgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas35
Plasmid#82387PurposesgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas28
Plasmid#82385PurposesgRNA targeting YFP expressed from pJ23108 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23108Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas27
Plasmid#82384PurposesgRNA targeting YFP expressed from pJ23117 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23117Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas15
Plasmid#82383PurposesgRNA targeting YFP (truncated to 18 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas14
Plasmid#82382PurposesgRNA targeting YFP (truncated to 15 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas13
Plasmid#82381PurposesgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPJ23119Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas73
Plasmid#82398PurposeΔccm:Km, used to delete ccm operonDepositorInsertccm deletion
PromoternoneAvailable SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9WT-NLS-3xHA-NLS-dSaCas9-2xNLS
Plasmid#107319PurposeExpresses SpCas9 fused to dSaCas9 in mammalian cellsDepositorInsertSpCas9-SaCas9 fusion
UseCRISPRTagsNLSExpressionMammalianMutationSpCas9 is fused to nuclease dead SaCas9 (D10A, N5…PromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN019-SpCas9-hiNLS-t-M1M4
Plasmid#234456PurposeExpresses hiNLS variant t-M1M4 inside 0C triNLS-SpCas9-NGGDepositorInsertSpCas9 hiNLS t-M1M4
UseCRISPRTagsHis6, Nucleoplasmin, SV40, and c-MycExpressionBacterialMutationCys at positions 80 and 574 have been mutated to …Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Hyg
Plasmid#232091PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9D10A nickase
Plasmid#216735PurposeExpresses SpCas9-D10A nickase from a miniCMV promoter. For AAV packaging. Derived from pX551-miniCMV-SpCas9, which was a gift from Alex Hewitt (Addgene #107031)DepositorArticleInsertCas9-D10A nickase
UseAAV and CRISPRExpressionMammalianMutationD10APromoterT7 and mini-CMVAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pScRad52-SpCas9 (pXK-1646)
Plasmid#208823PurposeCRISPR/Rad52-Cas9 expression vector for Animal gene editing, harboring the ScRad52-SpCas9 and a VEGFA.gRNA expression cassette. Key Construct: hU6-VEGFa.gRNA-CMV-ScRad52-SpCas9.DepositorTypeEmpty backboneUseCRISPR; Cas9TagsRad52ExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro G3BP1-sgRNA
Plasmid#196197PurposeCas9 + gRNA expression to edit G3BP1 locusDepositorInsertG3BP1 (G3BP1 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pScalps eSpCas9_Zsgreen gRNA scaffold
Plasmid#188449PurposeExpression of eSpCas9 tagged with ZsgreenDepositorTypeEmpty backboneUseCRISPR and LentiviralPromoterEF1-alphaAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-Puro HLAG-2A-sgRNA
Plasmid#182551PurposeCas9 from S.pyogenes with 2A-Puro, and the 2A-sgRNA to targeting exon 2 of human HLA-G geneDepositorInserthSpCas9-2A-Puro-HLAG-2A-sgRNA
UseCRISPRExpressionMammalianPromoterCbhAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only