We narrowed to 72,020 results for: nin
-
Plasmid#242819PurposeEncodes human kindlin1 containing kindlin2 F3 domain and N-terminal EBFP2 tagDepositorInsertKindlin1 (Fermt1 Human)
ExpressionMammalianMutationKindlin1 chimera containing the F3 domain of kind…Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DEST (JDW 471)
Plasmid#242573PurposeGateway destination vector with a CAGGS promoter in the backbone.DepositorTypeEmpty backboneUseGateway subcloningAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
EBFP2-K2K1
Plasmid#242820PurposeEncodes human kindlin2 containing kindlin1 F3 domain and N-terminal EBFP2 tagDepositorInsertKindlin2 (FERMT2 Human)
ExpressionMammalianMutationKindlin2 chimera containing the F3 domain of kind…Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Integrin β6β1-EGFP
Plasmid#242829PurposeEncodes human integrin β6 chimera containing integrin β1 cytoplasmic domain and C-terminal EGFP tagDepositorInsertIntegrin subunit beta 6, transcript variant 1 (ITGB6 Human)
ExpressionMammalianMutationIntegrin β6 chimera containing the cytoplasmic ta…Available SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-SV40
Plasmid#226453PurposeFor subcloning of SV40 promoter or for assays using M13 phageDepositorInsertSV40
UseCloning vectorMutationNoAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-N+C-term K-R
Plasmid#233093PurposeExpression of GST-YihI with N+C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with N+C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with N+C-term lysines (K) mutated to arg…Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-All K-R
Plasmid#233094PurposeExpression of GST-YihI with all lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with all lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationGST-YihI with all lysines (K) mutated to arginine…Available SinceMay 9, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXTK063 [Con-Pro_ipxC-Xantho_PartType8]
Plasmid#229300PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Constitutive-Promoter_ipxC-Xantho_PartType8DepositorInsertipxC Promoter (Xanthobacter flavus GJ10)
ExpressionBacterialAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK038 [Con-Pro_rpsL-Xantho_PartType5]
Plasmid#229275PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Constitutive-Promoter_rpsL-Xantho_PartType5DepositorInsertrpsL Promoter (Xanthobacter flavus GJ10)
ExpressionBacterialAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYI2206
Plasmid#228348PurposeConstitutive rPhlTA mutant expressionDepositorInsertphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1026
Plasmid#228299PurposeConstitutive expression of PhlTA mutant with weak promoter and terminatorDepositorInsertphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationE41GPromoterKpYPT1 promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT478
Plasmid#228286PurposeConstitutive mutant rPhlTA expression with strong promoterDepositorInsertrphlTA mutant
UseSynthetic BiologyTagsThree copies of VP16 (VP48)-Nuclear localization …ExpressionYeastMutationP5S, S6P, K86T, F109L, Q117R, E143KPromoterKpGAPDH promoterAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1392 (pLenti-CMV-FOXF1-P2A-H2A-mCherry)
Plasmid#233546PurposeA CMV driven human FOXF1 followed by a P2A cleavage peptide and an H2A mCherry fusion protein.DepositorAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK148 [Marker_TetR-tetAR-PaqCI-Compatible_PartType2]
Plasmid#229385PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Marker_TetR-tetAR-PaqCI-Compatible_PartType2DepositorInsertTetR-tetAR (PaqCI Compatible)
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK149 [Marker_TetR-tetAR-PaqCI-Compatible_PartType4]
Plasmid#229386PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Marker_TetR-tetAR-PaqCI-Compatible_PartType4DepositorInsertTetR-tetAR (PaqCI Compatible)
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXTK065 [Con-Pro_panD-Xantho_PartType8]
Plasmid#229302PurposeXanthoMoClo Golden Gate Part Plasmid for cloning, contains Constitutive-Promoter_panD-Xantho_PartType8DepositorInsertpanD Promoter (Xanthobacter flavus GJ10)
ExpressionBacterialAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only