We narrowed to 9,227 results for: sgRNA
-
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorPublicationInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-miniTurbo-LMNB1
Plasmid#207774PurposeDonor template for Blast-2A-miniTurbo insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-miniTurbo Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-V5-LMNB1
Plasmid#207779PurposeDonor template for Blast-2A-V5 insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-V5 Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-C-Solo-mScarlet-H3C2
Plasmid#207781PurposeDonor template for mScarlet insertion into the C-terminus of the H3C2 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H3C2 Addgene #207780DepositorInsertH3C2 Homology Arms flanking a mScarlet Tag (H3C2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mNeon-ACTB
Plasmid#207749PurposeDonor template for mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a mNeon Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
NarCas9_AAV
Plasmid#192145PurposeExpresses NarCas9?and cloning backbone for sgRNADepositorInsertNarCas9
UseAAVExpressionMammalianAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160a
Plasmid#173756PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160aDepositorInsertCas9_sgRNA1/R160a_sgRNA2/R160a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R160b
Plasmid#173757PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA160bDepositorInsertCas9_sgRNA1/R160b_sgRNA2/160b
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDe_Cas9_KANA_R390a
Plasmid#173758PurposeBinary expression vector with A.th. codon-optimized Cas9 and sgRNA for miRNA390aDepositorInsertCas9_sgRNA1/390a_sgRNA2/390a
UseCRISPRPromoterAtU6 &StU6Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sox3gRNA-T1
Plasmid#127777PurposeChicken sox3 gRNA target site 1, cloned into the pU6 sgRNA (backbone #92359)DepositorInsertsox3gRNAT1
UseCRISPRAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMM756
Plasmid#133600PurposePart Plasmid for ERG25 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgERG25
UseSynthetic BiologyAvailable sinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM755
Plasmid#133599PurposePart Plasmid for ERG11 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgERG11
UseSynthetic BiologyAvailable sinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM764
Plasmid#133601PurposePart Plasmid for TEF1 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgTEF1
UseSynthetic BiologyAvailable sinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0111
Plasmid#117575PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting ENTH/ANT {AT2G01600} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_ENTH/ANT {AT2G01600} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0100
Plasmid#117574PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting ENTH/ANT {AT1G14910} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_ENTH/ANT {AT1G14910} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0110
Plasmid#117573PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Protein kinase superfamily protein {AT1G73460} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_Protein kinase superfamily protein {AT1G73460} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0099
Plasmid#117572PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Protein kinase superfamily protein {AT1G73460} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_Protein kinase superfamily protein {AT1G73460} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0109
Plasmid#117571PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Flavin-binding monooxygenase family protein {AT1G62590} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_Flavin-binding monooxygenase family protein {AT1G62590} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0098
Plasmid#117570PurposeLevel1 Golden Gate Cassette: sgRNA cassette for spCas9, targeting Flavin-binding monooxygenase family protein {AT1G62600} in A. thalianaDepositorInsertPromoter_AtU6-26 + sa_gRNA_Flavin-binding monooxygenase family protein {AT1G62600} A. thaliana
ExpressionPlantPromoterAtU6-26 (pICSL90002)Available sinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR1CB0029
Plasmid#117541PurposeLevel1 Golden Gate Cassette: sgRNA cassette for LbCas12a, targeting NbPDS gene in N. benthamianaDepositorInsertcrRNA (LbCas12a)
ExpressionPlantAvailable sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only