We narrowed to 267,419 results for: addgene
-
Plasmid#115194PurposeLentiviral transduction and expression of PDHA2S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLEX307_PDHA2S291D/S293D
Plasmid#115195PurposeLentiviral transduction and expression of PDHA2S291D/S293D into any mammalian cellDepositorAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g3 (BB24)
Plasmid#139459PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 S3070F
Plasmid#139325PurposePlasmid expressing a sgRNA to introduce BRCA2 S3070F using base editingDepositorInsertsgRNA to insert BRCA2 S3070F using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 S1363L
Plasmid#139329PurposePlasmid expressing a sgRNA to introduce BRCA1 S1363L using base editingDepositorInsertsgRNA to insert BRCA1 S1363L using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA1 E1754K
Plasmid#139330PurposePlasmid expressing a sgRNA to introduce BRCA1 E1754K using base editingDepositorInsertsgRNA to insert BRCA1 E1754K using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA FANCD2 Q223Stop
Plasmid#139332PurposePlasmid expressing a sgRNA to introduce FANCD2 Q223Stop using base editingDepositorInsertsgRNA to insert FANCD2 Q223Stop using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgRNA BRCA2 R2896C
Plasmid#139511PurposePlasmid expressing a sgRNA to introduce BRCA2 R2896C using base editingDepositorInsertsgRNA to insert BRCA2 E2896C using base editing
ExpressionMammalianPromoterU6Available SinceMay 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
human ETV6 gRNA-3
Plasmid#133403Purposehuman ETV6 gRNA-3 is a 20-nt gRNA expression plasmid targeting the second ETV6 exon.DepositorAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-shCrh2
Plasmid#132710PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh geneDepositorAvailable SinceOct. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-TIRAP-cGASΔN-HA
Plasmid#130921PurposeExpresses human cGASΔN (aa160-522)-HA with an N terminal fusion of the TIRAP N terminus (aa1-85); Puromycin selection markerDepositorInsertTIRAP-ΔNcGAS
TagsHAExpressionMammalianMutationcGAS N terminus (aa1-159) replaced with the N ter…PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-Fyn-cGASΔN-HA
Plasmid#130922PurposeExpresses human cGASΔN (aa160-522)-HA with an N terminal fusion of the Fyn dual acylation motif (aa1-16); Puromycin selection markerDepositorInsertFyn-ΔNcGAS
TagsHAExpressionMammalianMutationcGAS N terminus (aa1-159) replaced with the dual …PromoterCMVAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFB-U6-Chrna6-gRNA-hSyn-mCherry-WPRE-SV40pA
Plasmid#128341PurposepAAV encoding gRNA sequence for loss-of-function indelsDepositorAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
289aa ELL2
Plasmid#127266PurposeFor in vitro translation of shorter human ELL2 from Met1. Also contains Met133I, M1381I, M186I mutations.DepositorInsertNH2-ELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to Ileu. Contains 289…PromoterT7Available SinceJuly 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Xba ELL2 Met133, 138, 186 to Ileu
Plasmid#127269PurposeFor in vitro translation of ELL2 with with internal HA tag and Met133, 138, 186 IleuDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu HA tag after M186PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2 Met133, 138, 186 to Ileu
Plasmid#127271PurposeFor in vitro translation of human ELL2 with Met133, 138, 186 to Ileu with HA tag after 8th MetDepositorInsertELL2 Met133, 138, 186 to Ileu (ELL2 Human)
UseIn vitro translationMutationMet133, 138, 186 to Ileu with HA tag after 8th MetPromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only