We narrowed to 9,843 results for: CAG
-
Plasmid#257580PurposesgRNA targeting GLRX5DepositorInsertGLRX5 (GLRX5 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA); EFS (Cas9 + puroR)Available SinceJune 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Gollum Target 3- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210747PurposeCoding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 3DepositorInsertsSaSp Cas9
Gollum sgRNA GFP Target 3
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Merry Target 1- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
Plasmid#210741PurposeCoding for SaSp Cas9 alongside Merry sgRNA targeting GFP Target 1DepositorInsertsSaSp Cas9
Merry sgRNA GFP Target 1
UseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationN-terminal Sa Cas9, C-terminal Sp Cas9PromoterH1 and eCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-12
Plasmid#129040Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA12 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA12 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-3
Plasmid#129031Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA3 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA3 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR1 gRNA (BRDN0001146877)
Plasmid#76068Purpose3rd generation lentiviral gRNA plasmid targeting human FGFR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001145533)
Plasmid#76034Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-12
Plasmid#129052Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA12 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA12 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-3
Plasmid#129043Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA3 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA3 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(23))-PGKpuroBFP-W
Plasmid#200508PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(47))-PGKpuroBFP-W
Plasmid#200505PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97A-IRES-EGFP
Plasmid#183457PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97A variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW-shRIIα-RIIαS97E-IRES-EGFP
Plasmid#183458PurposeReplacement of endogenous rat PKA-RIIα subunits with the RIIα S97E variantDepositorInsertsgRNA and Prkar2a (Prkar2a Rat)
UseLentiviralMutationshRNA-resistant mutations: C135>G, G138>A, …PromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBP-E3-HA
Plasmid#236182PurposeOther half of photoactivatable GFE3. When co-expressed with tagRFP-GPHN.FingR-PhoCl (Plasmid #236183), ablates inhibitory synapses after exposure to 400 nm light.DepositorInsertPBP-E3-HA
ExpressionMammalianAvailable SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
eDHFR-E3
Plasmid#236113PurposeHalf of chemically inducible GFE3. When co-expressed with 236112 can degrade inhibitory synapses in presence of TH. (trimethoprim-HaloTag ligand).DepositorInserteDHFR-E3
ExpressionMammalianAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -