We narrowed to 36,270 results for: Nes
-
Plasmid#215486PurposeLentiviral expression of human alpha-synuclein in mammalian cellsDepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.1-hSNCA-NE
Plasmid#102361PurposeOverexpression of synuclein alpha in mammalian cellsDepositorAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIN-hSNCA-NE
Plasmid#102366PurposeLentiviral overexpression of synuclein alphaDepositorInsertsynuclein alpha (SNCA Human)
UseLentiviralTagsNEExpressionMammalianMutationA silent mutation (333bp downstream of ATG) was i…PromoterEF-1aAvailable SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hUCP4-NE
Plasmid#102362PurposeOverexpression of solute carrier family 25 member 27 in mammalian cellsDepositorInsertsolute carrier family 25 member 27 (SLC25A27 Human)
TagsNEExpressionMammalianPromoterCMVAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGFP-nE-mHP1alpha
Plasmid#181895PurposeFluorescently tagged HP1alpha, serines in N-terminal extension (NTE) replaced by glutamatesDepositorInsertnE-mHP1alpha (Cbx5 Mouse)
TagsGFPExpressionMammalianMutationS11E, S12E, S13E, S14EPromoterCMVAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0046-EF1a-PspCas13b-NES-HIV
Plasmid#103862PurposeExpresses PspCas13b in mammalian cells for knockdown of target RNAs in combination with compatible guide RNAs. Localized to the cytoplasmDepositorInsertPspCas13b
UseCRISPR and LentiviralTags3xHA and HIV NESExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_hsyn_NES-his-CaMPARI2-WPRE-SV40
Plasmid#101060PurposeAAV vector expressing CaMPARI2 (Kd = 200nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorHas ServiceAAV1InsertCaMPARI2
UseAAVTagsFLAG-HA-myc and NES_hisPromoterhsyn (synapsin-1)Available SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-2xGFP:NES-IRES-2xRFP:NLS
Plasmid#71396Purpose2Gi2R assayDepositorInserts2xGFP:NES
2xRFP:NLS
UseLentiviralTagsIRESExpressionMammalianPromoterEF1alpha and IRESAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-mCherry-NES reporter (pDN160)
Plasmid#72660PurposeNLS-mCherry-NES 17 reporter for light-inducible nuclear export block with pDN157 and pDN158DepositorInsertNLS-mCherry-NES
ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0045-EF1a-PguCas13b-NES-HIV
Plasmid#103861PurposeExpresses PguCas13b in mammalian cells for knockdown of target RNAs in combination with compatible guide RNAs. Localized to the cytoplasmDepositorInsertPguCas13b
UseCRISPR and LentiviralTags3xHA and HIV NESExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC0044-EF1a-RanCas13b-NES-mapk
Plasmid#103855PurposeExpresses RanCas13b in mammalian cells for knockdown of target RNAs in combination with compatible guide RNAs. Localized to the cytoplasmDepositorInsertRanCas13b
UseCRISPR and LentiviralTags3xHA and mapk NESExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES-mCE NLS
Plasmid#82466PurposeExpresses cytoplasmic restricted form of myc tagged mRNA capping enzymeDepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-NES-NIR-GECO1
Plasmid#113683PurposeExpress NIR-GECO1 preferentially in neuronsDepositorInsertNES-NIR-GECO1
UseAAVPromoterhSynAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP-AsLOV2-NES27 (pDN158)
Plasmid#72659PurposeConstitutively nuclear variant of a very strong, photocaged NES (AsLOV2-NES 27) for blocking endogenous, CRM-1-dependent nuclear exportDepositorInsertH2B-GFP-AsLOV2-NES27
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NES-mut
Plasmid#42001DepositorInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationF951A, F955A, I958A, F960APromoterCMVAvailable SinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
867 pSG5L HA NES PTEN G129R
Plasmid#10934DepositorAvailable SinceJan. 3, 2006AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-myc NES- mCE(K294A)
Plasmid#82464PurposeExpresses myc tag and catalytic inactive form of mRNA capping enzyme with N terminal Nuclear export signal (NES)DepositorInsertNES mRNA capping enzyme (Rngtt HIV, Mouse)
TagsmycExpressionMammalianMutationK294APromoterCMVAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-bio-myc-NES-EGFP
Plasmid#112712PurposeFor tetracycline-inducible expression of bio-myc-NES-EGFP in mammalian cellsDepositorInsertEGFP
TagsHIV Rev nuclear localization signal (NES), biotin…ExpressionMammalianMutationNucleotide sequence optimized for synthetic gene …PromoterCMV with Tet repressor binding sitesAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only