We narrowed to 23,589 results for: ica;
-
Plasmid#184002PurposeAAV production for expression of optically controlled eDrTrkB with N-terminal fusion of mCherryDepositorAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1985 - [1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
Plasmid#159846PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - TagBFP2(PATC, NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2249 - [1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
Plasmid#159847PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-GFP (1 intron, syntrons(3), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4134357
Plasmid#152589PurposeMammalian expression plasmid for SARS-CoV-2 M (membrane)DepositorInsertSARS-CoV-2 M (membrane) (M Severe acute respiratory syndrome coronavirus 2)
TagsCleavable TEV;6xHis-003ExpressionMammalianMutationwtPromoterCMVAvailable SinceJuly 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEBTet-SNAP-Cep78
Plasmid#136827PurposeMammalian expression of the centrosomal protein Cep78 N-terminally fused to SNAP-tagDepositorInsertSNAP-Cep78 (CEP78 Synthetic, Human)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a-C9ORF80
Plasmid#128418PurposeExpress C9ORF80 in E. coli with a His tag (C-terminal)DepositorAvailable SinceAug. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRG/III-hs-MBP-T43NTR-TrxA-H10
Plasmid#121677PurposeBacterial expression of neurotensin receptor fusion proteinDepositorInsertneurotensin receptor (Ntsr1 Rat)
TagsTrxA-H10ExpressionBacterialMutationdeleted amino acids 1-42PromoterlacAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα1(I)
Plasmid#119844PurposeExpresses mouse Type I procollagen α1 chain (Col1a1) with mApple replacing exon 2-3 retaining N-propeptide minor triple helix and N-terminal cleavage siteDepositorInsertType I procollagen α1 chain (Col1a1 Mouse)
TagsmAppleExpressionMammalianMutationCol1a1 exons 2-3 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
mApple-proα2(I)
Plasmid#119840PurposeExpresses mouse Type I procollagen α2 chain (Col1a2) with mApple between signal sequence and exon 6DepositorInsertType I procollagen α2 chain (Col1a2 Mouse)
TagsmAppleExpressionMammalianMutationCol1a2 exons 2-5 replaced by fluorescent tagPromoterCMVAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR55
Plasmid#106026PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR55; Opto-GPR55; C4)DepositorInsertOpto-GPR55 (GPR55 Human, Bovine)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-Myc-SNAP29
Plasmid#116944PurposeExpressing Myc-SNAP29 for mammalian cellsDepositorInsertsynaptosomal-associated protein, 29kDa (SNAP29 Human)
UseRetroviralTagsMycExpressionMammalianPromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
RECQL5 (RECQL5A-c011)
Plasmid#98231PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertRECQL5A (RECQL5 Human)
TagsHis-6-TEVExpressionBacterialMutationpfam00270:DEAD 29-203, pfam00271:Helicase_C 251-3…PromoterT7Available SinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKS7107
Plasmid#89051PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9DepositorInsertsNm crRNA
Nm tracrRNA
hNmCas9
UseCRISPRTagsHA tag, NLS, and SV40 NLSPromoterEF1a and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
Cntn2-AP-His
Plasmid#71940PurposeExpresses the extracellular region of the Contactin 2 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ncam1_1.18.1-Fc-His
Plasmid#72088PurposeExpresses the extracellular region of the NCAM1, isoform 1.18.1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
Neo1.a-AP-His
Plasmid#71963PurposeExpresses the extracellular region of the Neogenin 1, isoform a protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAC-aZEA
Plasmid#53286PurposeContains crtE, and crtB genes of Erwinia herbicola (Pantoea agglomerans) Eho10, crtI gene of Rhodobacter capsulatus, and lcyE cDNA of Arabidopsis thaliana and produces alpha-zeacarotene in E. coliDepositorAvailable SinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pmECFPN3/GgVcl 1-1066 (CFP at C term)
Plasmid#46280DepositorAvailable SinceJuly 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Syx2
Plasmid#35705DepositorAvailable SinceJune 22, 2012AvailabilityAcademic Institutions and Nonprofits only