We narrowed to 19,878 results for: INO
-
Plasmid#208946PurposeA variant CE1 construct with DCV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertDCV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 variant click editor (CE1) - pCMV-T7-PCV2-nSaCas9-EcKlenow (MLE194)
Plasmid#217801PurposeVariant CE1 construct with SaCas9, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSaCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSaCas9(N580A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV2E
Plasmid#224441PurposeRep/Cap plasmid for the production of MyoAAV 2E, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDQGYQ insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3D
Plasmid#224445PurposeRep/Cap plasmid for the production of MyoAAV 3D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYREL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3E
Plasmid#224446PurposeRep/Cap plasmid for the production of MyoAAV 3E, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4B
Plasmid#224449PurposeRep/Cap plasmid for the production of MyoAAV 4B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYTSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4D
Plasmid#224451PurposeRep/Cap plasmid for the production of MyoAAV 4D, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHGVL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV4C
Plasmid#224450PurposeRep/Cap plasmid for the production of MyoAAV 4C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYTSM insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3C
Plasmid#224444PurposeRep/Cap plasmid for the production of MyoAAV 3C, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYSSV insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3B
Plasmid#224443PurposeRep/Cap plasmid for the production of MyoAAV 3B, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYSGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-ChR2(ET/TC)-EYFP
Plasmid#137141PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_016-sgATF4-1
Plasmid#202455PurposeExpression of a guide RNA targeting ATF4DepositorAvailable SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT3-EFa1-HA-Jag1
Plasmid#46051DepositorAvailable SinceJuly 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
Unfused click editor construct; PCV2-EcKlenow fusion - pCMV-T7-PCV2-EcKlenow (JO1421)
Plasmid#217804PurposeUnfused click editor construct expressing PCV2-EcKlenow, expressed from CMV or T7 promoters.DepositorInsertPCV2-linker-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceSept. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-GCaMP6M
Plasmid#137120PurposeIntersectional viral expression of GCaMP6M in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-GCaMP6M
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationRemoved RSET tagPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS D614G soluble Spike
Plasmid#164651PurposeExpresses SARS-CoV-2 soluble Spike protein with a D614G mutationDepositorInsertSARS-CoV-2 soluble spike (S SARS-CoV-2)
TagsHISExpressionMammalianMutationD614GPromoterCAGAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 KBTBD4 WT
Plasmid#184624PurposeDoxycycline inducible lentiviral vector for N-terminal Flag tagged KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal Flag tagged KBTBD4 WT (KBTBD4 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationno mutationPromoterTRE promoter, Tet ONAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Coff/Fon-NpHR3.3-EYFP
Plasmid#137154PurposeIntersectional viral expression of NpHR3.3-EYFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-NpHR3.3-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationW179FPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-MSMV-nCas9-EcKlenow (JO661)
Plasmid#208947PurposeA variant CE1 construct with MSMV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertMSMV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only