We narrowed to 16,712 results for: grna
-
Plasmid#66894PurposeExpresses an Lkb1-targeting gRNA and Cre-recombinaseDepositorInsertsgLkb1
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.2#2/Cre
Plasmid#173661PurposeExpresses a NT.2-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNeo/Cre
Plasmid#67594PurposeExpresses an Neomycin-targeting gRNA and Cre-recombinaseDepositorInsertsgNeo
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.3#3/Cre
Plasmid#173662PurposeExpresses a NT.3-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
sgSf3b1(T1)
Plasmid#90424Purposeinduces dsDNA break within mouse Sf3b1 gene for subsequent homology-directed recombination and coding sequence mutagenesis at codon 700DepositorInsertmus Sf3b1 gRNA (Sf3b1 Mouse)
UseCRISPR; Guiderna encoding for gene editingExpressionMammalianPromoterU6Available SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1
Plasmid#92433Purposeexpresses Cas9 and gRNA targeting PAFAH1B1DepositorAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Intron4-PAFAH1B1
Plasmid#92434Purposeexpresses Cas9 and gRNA targeting PAFAH1B1DepositorAvailable SinceJuly 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only