We narrowed to 82,961 results for: MYC;
-
Plasmid#83235PurposepGREG600-His6-Sem1Sc, Expresses the His6-Sem1 in yeastDepositorAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR
Plasmid#123346PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase C activity.DepositorInsertCerulean3-Cerulean3-FLARE-CKAR
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-GFP-FLARE-AKAR
Plasmid#123332PurposeGreen-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertGFP-GFP-FLARE-AKAR
Tags6xHIS, EGFP, T7 tag (gene 10 leader), and Xpress …ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-MED9
Plasmid#15407DepositorAvailable SinceAug. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterExpressionYeastPromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Venus-Venus-FLARE-AKAR
Plasmid#123331PurposeYellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring Protein Kinase A activity.DepositorInsertVenus-Venus-FLARE-AKAR
Tags6xHIS, T7 tag (gene 10 leader), Venus, and Xpress…ExpressionMammalianPromoterCMVAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV
Plasmid#123342PurposeCyan-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertCerulean3-Cerulean3-FLARE-EKAR-EV
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBT259_(pRosa26-G-tTA2)
Plasmid#36878DepositorInsertsGFP
tTA2
beta-globin intron
Neo
diphteria toxin A
ExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mCherry-mCherry-FLARE-EKAR-EV
Plasmid#123341PurposeRed-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity.DepositorInsertmCherry-mCherry-FLARE-EKAR-EV
Tags6xHIS, T7 tag (gene 10 leader), Xpress (TM) tag, …ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GST-MED9
Plasmid#15408DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Flot2-GFP
Plasmid#252028PurposeDelivery of Flot2 gene into mammalian cellsDepositorAvailable SinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-CNOT6-V5H6.MCh.Puro
Plasmid#209944PurposeIn mammalian cells expresses TP fused to a CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
TagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianPromoterCBh and CMVAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPD1178-LPDV promoterless PuroR-P2A-miRFP720
Plasmid#201537PurposeLanding pad destination vector for mMoClo golden gate-based assembly of landing pad integration vectors; contains BxB1 attB site, promoterless puromycin resistance gene and miRFP720 geneDepositorInsertPromoterless PuroR-P2A-miRFP720
ExpressionMammalianPromoterNoneAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only