We narrowed to 25,288 results for: crispr
-
Plasmid#164967PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgCry1_2-hU6-sgCry2_1-hU6-sgCry2_2
UseAAVTagsmCherryPromoterhU6, hSynAvailable sinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-iSpyMac
Plasmid#149553PurposeGateway entry clone for CRISPR-iSpyMacCas9 genome editing at NAAR PAMsDepositorInsertiSpyMacCas9
UseCRISPR; Gateway compatible zispymaccas9 entry clo…Tags3X FLAG, NLS and NLSExpressionPlantMutationR221K, N394K, Protospacer interacting domain form…Available sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB6638
Plasmid#106165PurposeEasyCloneYALI system-based yeast gRNA expression vector carrying a nourseothricin-resistance marker, helps to integrate vector pCfB6679 into Yarrowia lipolytica chromosomal location IntE_4, amp resistanceDepositorInsertunknown
ExpressionYeastAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU1/Sm/3' Box_(GLuc)_INT
Plasmid#68438PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U1Pro/SmBox/3' Box expression backbone.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertINT construct_bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U1Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP215.rAAV.mU6-sgRNA.Handle.EF1a-mTagBFP2
Plasmid#217635PurposeAAV backbone for sgRNA expression. Contains a Lox-flanked handle sequence for Cre-dependent PCR amplification of sgRNAs. Protospacer is cloned between BstXI and BlpI.DepositorInsertmU6-sgRNA, Handle sequence, EF1a-mTagBFP2
UseAAVPromoterEF1alpha and mU6Available sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVNP3.0-PEmaxRH
Plasmid#206884PurposeExpresses FLAG-tagged PEmax (lacking the RNAseH domain) fused to Gag through a linker sequenceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPEMax Delta RNAseH
TagsFLAGPromoterCMVAvailable sinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(CTRL)-CMV-eGFP
Plasmid#194017PurposeExpresses a gRNA that targets the LacZ gene (serves as control) and eGFPDepositorInsertssgRNA(CTRL)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAT105
Plasmid#180510PurposePlasmid expressing mammalian codon optimized engineered DpbCasX-R3, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCasX sgRNAv2
DpbCasX with R3 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGLOW39
Plasmid#173068PurposemScarlet^SEC^3xMyc vector with ccdB sites for cloning homology armsDepositorInsertmScarlet-I-C1^SEC^3xMyc
UseCRISPR and Cre/LoxTags3xMyc and C. elegans codon-optimized mScarletExpressionWormAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP308-pAAV-EFS-dSaCas9-VP64-Dio-pA
Plasmid#113685PurposeAn EFS driven inverted de-catalyzed SaCas9 fused to the transcription activator VP64. dSaCas9-VP64 is floxed to render the system cre-dependent.DepositorInsertinverted de-catalyzed SaCas9
UseAAV, CRISPR, Cre/Lox, and Synthetic BiologyTagsNLS and VP64Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCfB2904(XI-3 MarkerFree)
Plasmid#73276PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-3 (Chr XI: 93378..94567)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDGB3 alpha1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1656)
Plasmid#160618PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-MYC-Guide-hSpCas9
Plasmid#228574PurposeExpression of human MYC gRNA; CRISPR mediated gene insertionDepositorAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9 fused to nanobody (anti-beta catenin)
Plasmid#186420PurposeExpression of dCas9 with C-terminal nanobody fusion recognizing beta catenin tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-nanobody fusion (anti-beta catenin)
UseCRISPRTags6HisAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV272
Plasmid#226183PurposeExpresses Cas9 and gRNA targeting uidA gene of the pDIV643 derived cassette.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-D156R (ttLbCas12a)
Plasmid#195366PurposeA temperature-tolerant LbCas12a mutant (D156R), also known as ttLbCas12aDepositorInsertLbCas12a-D156R (ttLbCas12a)
UseCRISPR; Gateway compatible lbcas12a-d156r (ttlbca…ExpressionPlantPromoterZmUBI1Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBRC1
Plasmid#183064PurposeBase editing plasmid for Pseudomonas chlororaphisDepositorInserteSpCas9ppD10A
UseCRISPR and Synthetic BiologyAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0114 pu6-eco31i-eco31i-dis7-11-mature-dr-guide-scaffold
Plasmid#186981Purposemammalian expression of Cas7-11 crRNA guideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmature DR guide
ExpressionMammalianAvailable sinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
Plasmid#164262PurposeVector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.DepositorInsertCodon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
ExpressionBacterialAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by