We narrowed to 29,789 results for: Egf
-
Plasmid#190270PurposeLentiviral conditional expression of mitochondrial-targeted eGFP in mammalian cellsDepositorInsertMTS-EGFP
UseLentiviralTagsEGFPExpressionMammalianPromoterTight TRE promoterAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-eGFP-Cre
Plasmid#120219PurposeExpresses cre under the control of CamKIIa promotorDepositorInsertcre
UseAAV and Cre/LoxTagsEGFPAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1-FLAG-IRES-eGFP
Plasmid#234619PurposeMammalian expression of full-length hnRNPA1 with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationC-terminal FLAG tag, co-expressing with eGFP via …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-CMV-MCS-Puro-EGFP
Plasmid#219795PurposeMammalian expression plasmids using piggyBac Transposon SystemDepositorTypeEmpty backboneUsePiggybac transposonExpressionMammalianAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-MRLC1 T18D, S19D
Plasmid#35682DepositorAvailable SinceApril 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Frankenbody-FLAG-mEGFP
Plasmid#175293PurposeTrack mature and nascent FLAG tagged proteins in live cellsDepositorInsertanti-FLAG frankenbody fused with mEGFP
TagsmEGFPExpressionMammalianAvailable SinceOct. 7, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDH-EF1-IRES eGFP
Plasmid#128059PurposeLentiviral expression of an insert from EF1 promoter and co-expression of EGFP. See Depositor Comments for additional information regarding plasmid sequence.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-PERK(LD)-EGFP-HOTag3
Plasmid#225678PurposeUsed to generate stable cell lines that express PERK(LD)-EGFP-HOTag3 and to detect the unfolded proteins in the ER lumen.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase
Plasmid#119816Purpose3rd generation lentiviral plasmid for expression of EGFP Firefly Luciferase fusion protein in mammalian cellsDepositorInsertsLuciferase
Puromycin
UseLentiviral and LuciferaseTagsEGFP and V5ExpressionMammalianMutationStop codon removed in the frame of the V5 frame v…PromoterCMV/TO and Human Phosphoglycerate kinaseAvailable SinceJan. 2, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAM-AAV-mSncg-EGFP
Plasmid#153163PurposeMouse gamma-synuclein (mSncg) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianPromotermSncgAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-Actin
Plasmid#119870PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse Beta ActinDepositorInsertbeta Actin (Actb Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceFeb. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
mCherry-7aa-cb5-pEGFP-C1
Plasmid#177407PurposeTo express mCherry fused to endoplasmic reticulum (ER) targeting sequence "Cb5". mCherry faces the cytosol.DepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-AID-BubR1
Plasmid#47330Purposefor plasmid integration using the Flp-In system. AID at N-terminalDepositorInsertBUB1 mitotic checkpoint serine/threonine kinase B (BUB1B Human)
TagsAID and GFPExpressionMammalianMutationsiRNA resistantAvailable SinceSept. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-EGFP-KASH
Plasmid#154373PurposeVector for Cre-dependent expression of EGFP tagged KASH protein domainDepositorInsertEGFP-KASH
UseAAV and Cre/LoxExpressionMammalianAvailable SinceAug. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
3xFlag-eGFP-Flag-SETX
Plasmid#218838PurposeMammalian expression of GFP-tagged SETX construct for subcellular localization studies with GFP, or immunoprecipitation with Flag tag.DepositorAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
TetOn-mCherry-eGFP-RAMP4
Plasmid#109014PurposeTet-On construct to induce expression of tandem eGFP-mCherry tagged RAMP4 (ER marker)DepositorInsertRAMP4 (SERP1 Human)
UseLentiviralTagsmCherry-eGFPExpressionMammalianPromoterCMV promoterAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Venus-30aa-Noxa-pEGFP-C1
Plasmid#166762PurposeTo increase the length of the linker between Venus and Noxa proteinsDepositorAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-3xHA-eGFP-OMP25
Plasmid#239249Purpose3xHA-eGFP-OMP25 lentiviral overexpression vectorDepositorAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdest N-FLAG EGFP puro
Plasmid#223056PurposeEGFP gene expression in mammalian cellsDepositorInsertEGFP
UseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceFeb. 24, 2025AvailabilityAcademic Institutions and Nonprofits only