We narrowed to 17,148 results for: tes
-
Plasmid#21806DepositorInsertSHP-1 (PTPN6 Human)
TagsGFPExpressionMammalianMutationchanged Serine 591 to Aspartic AcidAvailable SinceAug. 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
pTol2 - myo6b:CaSR-EGFP, cryaa:mCherry
Plasmid#191500PurposeGROW AT 30 DEGREES. A construct used to create transgenic fish that express CaSR-EGFP in hair cells and an mCherry marker in the lens of the eyeDepositorInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol2 transgenes…Promotermyo6bAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
delCMV-mCherry-2x-Rhotekin-GBD
Plasmid#214142PurposeRho activity sensorDepositorInsert3xRhotekin-GBD (Rtkn Mouse)
TagsmCherryExpressionMammalianMutationOnly the GTPase binding domain (GBD) is includedPromoterdelCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAGIG-H2B-V5-mScarlet
Plasmid#191093PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertH2B and mScarlet
UseAAVTagsH2B-V5-mScarletExpressionMammalianMutationThe fusion protein was optimized to the Human cod…PromoterCMV and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mGreenLantern-KASH
Plasmid#191094PurposeTo express a bright monomeric green FP to label the eucaryotic nuclear envelope. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmGreenLantern-KASH
UseAAV and Synthetic BiologyTagsmGreenLantern fused to the KASH domain of Nesprin…ExpressionMammalianMutationOptimizzation was done using the Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRG645_lexO-AscI_LexA-TF_LEU2MX
Plasmid#154813PurposeInducible expression of AscI endonuclease in S. cerevisiaeDepositorInsertsAscI endonuclease
LexA-ER-B112
TagsFLAG and NLSExpressionYeastPromoterACT1 and lexO_4-CYC1_coreAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBMN-AS-HNF4α
Plasmid#139305PurposeKnocking down of human HNF4α through shRNA and amiRNA targeting HNF4αDepositorInsertshRNA and amiRNA against HNF4α
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-intron-BaLgp160
Plasmid#100918PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolateDepositorInsertHIV-1 (BaL) Env with upstream intron
TagsCD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic genePromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Brg1 Del4 pET28C
Plasmid#122118PurposeExpression Brg1 amino acids 1446-1647 in bacteriaDepositorAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-Myc-YWAA-pGK-HYG
Plasmid#107377PurposeLentiviral expression of myc-YWAADepositorInsertcereblon (CRBN Human)
UseLentiviralTagsMycExpressionMammalianMutationCRBN-Y383A/W385APromoterUbcPAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ULK2-K39I
Plasmid#97076PurposeExpresses mutant ULK2 in mammalian cellsDepositorInsertULK2 (ULK2 Human)
TagsFLAGExpressionMammalianMutationchanged Lysine 39 to IsoleucinePromoterCMVAvailable SinceAug. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-mTET2 (N500)
Plasmid#89897PurposeExpresses mouse TET2 N500 truncation in mammalian cellsDepositorInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianMutationN-term 500 truncation of mouse TET2 (contains fir…Available SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS1-3xFLAG
Plasmid#84883PurposerAAV-based template for genome engineering of protein C-termini containing PQS1 and 3xFLAG tags and a selection cassetteDepositorInsertMulticloning sites and selection cassette
UseAAVPromoterPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATF4 12: 5’ATF4.uORF1AUA.GFP
Plasmid#21859DepositorInsertATF4 (Atf4 Mouse)
TagsEGFPExpressionMammalianMutationAUG codon of uORF1 was converted to AUAAvailable SinceSept. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pIS1 IMP-1 short UTR
Plasmid#21639DepositorInsertIGF-II mRNA-binding protein 1 (IGF2BP1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGFP-mHP1beta
Plasmid#181901PurposeFluorescently tagged HP1betaDepositorAvailable SinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tollip M240A,F241A
Plasmid#178051PurposeGFP fused to human Tollip cDNA carrying mutations in the CUE domain. Localisation and expression in mammalian cells.DepositorInsertToll-Interacting Protein (TOLLIP Human)
TagsGFPExpressionMammalianMutationChanged Methionine 240 to Alanine and changed Phe…PromoterCMVAvailable SinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only