We narrowed to 8,092 results for: 104
-
Plasmid#75698Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
GP805
Plasmid#164545PurposeExpresses Smo-FLAG K348, 360, 434, 444, 448, 543, 565, 568, 569, 575, 579, 628, 671, 676, 677, 678, 681, 682, 683, 684, 717RDepositorInsertSmoothened K348, 360, 434, 444, 448, 543, 565, 568, 569, 575, 579, 628, 671, 676, 677, 678, 681, 682, 683, 684, 717R (Smo Mouse)
UseLentiviralTagsFLAGMutationAll 21 cytoplamic Lysines of Smoothened changed t…PromoterGgCryD1Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLIB_GST-nsp13 (SARS-CoV-2)
Plasmid#169190PurposeBaculoviral transfer vector to express GST-nsp13 (SARS-CoV-2) in insect cellsDepositorInsertGST-nsp13 (ORF1ab SARS-CoV-2, Synthetic)
TagsGSTExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
HIPK3 gRNA (BRDN0001146408)
Plasmid#77032Purpose3rd generation lentiviral gRNA plasmid targeting human HIPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK2 gRNA (BRDN0001162199)
Plasmid#75701Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AP2u2-CMV-Ace2-IgG1
Plasmid#226455PurposeMammalian expression of human Ace2 protein under CMV promoter fused with IgG1, tagged with 6His, and released extracellular environment after expression for protein purificationDepositorInsertsAngiotensin Converting Enzyme 2
Immunoglobulin Heavy Constant Gamma 1
Tags6xHis TagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10A
Plasmid#229403PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
HA-MAP4K4-10D
Plasmid#229404PurposeLentiviral or overpexression of cDNADepositorInsertMAP4K4 (MAP4K4 Human)
UseLentiviralTagsHAExpressionMammalianMutationMARK2 phosphosites (S523,S536,S547,S643,T684,S726…PromoterEFSAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-VCF1 N167A
Plasmid#223019PurposeExpression of GFP-tagged VCF1 (p97 binding-deficient N167A mutant) in mammalian cells.DepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Strep-HA-VCF1 N167A
Plasmid#223021PurposeExpression of Strep-HA-tagged VCF1 (p97 binding-deficient N167A mutant) in mammalian cells.DepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-HsNot1iso1_1093-1317-K1208AH1212AK1218A_T
Plasmid#147574PurposeBacterial Expression of HsNot1iso1_1093-1317-K1208AH1212AK1218ADepositorInsertHsNot1iso1_1093-1317-K1208AH1212AK1218A (CNOT1 Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1ΔN (MT2B2)-HA
Plasmid#178031PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rufy3 scFv [N483/126]
Plasmid#190557PurposeMammalian Expression of Rufy3 scFV. Derived from hybridoma N483/126.DepositorInsertRufy3 (Mus musculus) recombinant scFV (Rufy3 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Rufy3 scFv [N483/126]
Plasmid#182089PurposeMammalian Expression of Rufy3 scFv. Derived from hybridoma N483/126.DepositorInsertrecombinant mouse scFv targeting Rufy3 (Mus musculus) (Rufy3 Mouse)
TagsSortase, HisExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRKAG2 gRNA (BRDN0001145518)
Plasmid#77463Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAG2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HIPK3 gRNA (BRDN0001147814)
Plasmid#77030Purpose3rd generation lentiviral gRNA plasmid targeting human HIPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HIPK3 gRNA (BRDN0001146732)
Plasmid#77031Purpose3rd generation lentiviral gRNA plasmid targeting human HIPK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LCK gRNA (BRDN0001145572)
Plasmid#76411Purpose3rd generation lentiviral gRNA plasmid targeting human LCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LCK gRNA (BRDN0001145503)
Plasmid#76412Purpose3rd generation lentiviral gRNA plasmid targeting human LCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only