We narrowed to 70,188 results for: nin
-
Plasmid#198557PurposeExpresses human codon-optimized SpCas9-NRCH-CGBE1 and blasticidin resistance: EFS promoter-SpCas9-NRCH-CGBE1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-CGBE1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-hs_Cldn5 (JDW 1120)
Plasmid#224481PurposeGateway compatible 5' entry clone containing the Human Claudin 5 promoterDepositorInsertClaudin-5 promoter
ExpressionMammalianAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEXP(FLAG/HA-NSP1-K164-H165A)
Plasmid#188782PurposeExpresses FLAG/HA-NSP1-K164-H165A in mammalian cells (SARS-CoV-2 mutant NSP1)DepositorInsertFLAG/HA-NSP1-K164-H165A (SARS-CoV-2)
UseFrt site to insert into hek293 t-rex genomeTagsFLAG/HAExpressionMammalianMutationChanged Lysine 164 to Alanine and Histidine 165 t…PromoterCMV Dox inducibleAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
T40A+Q54A
Plasmid#217913PurposeA plasmid encoding the hydrogel-forming protein PXP with both the T40A and Q54A coil mutationsDepositorInsertPXP T40A+Q54A
Tags6x His (N and C term)ExpressionBacterialMutationThreonine at position 41 and 253 mutated to Alani…PromoterT5Available SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SSH-pcDNA3.1-SSH-SARS-CoV-2-S-WT
Plasmid#218460PurposeMammalian expression plasmid for SARS-CoV-2 spike (1273 residues)DepositorInsertSARS-CoV-2 spike protein (1273 residues)-wild type (S )
ExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPAP_scFv_V50A
Plasmid#183734PurposeExpresses anti-lysozyme scFv antibody with V50A mutation on MFalpha signalDepositorInsertAnti-lysozyme scFv
TagsHis6-tagExpressionYeastMutationV50A mutation in MFalpha signalPromoterAOX1 promoterAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-SpG C aa714-1368-U6-Lmna sgRNA1
Plasmid#208110PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertSpG C, U6, Lmna sgRNA1, scaffold
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1
Plasmid#179923PurposeExpression vector for heterologous expression of a polyketide synthase in S. cerevisiae. Carries and empty insertion site and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertFvPPT1
ExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
P15-pZE-SUMO-PiTTA
Plasmid#204630PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized piTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-BuTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P17-pZE-SUMO-CsTTA
Plasmid#204631PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized csTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-CsTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P18-pZE-SUMO-BuTTA
Plasmid#204632PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized buTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-BuTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P24-pZE-SUMO-KaTTA
Plasmid#204633PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized kaTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-KaTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pINDUCER21-puro_TAOK2-D151A
Plasmid#172980Purposedoxycycline-inducible expression of kinase-dead TAOK2DepositorInsertkinase-dead TAOK2 (TAOK2-D151A) (TAOK2 Human)
UseLentiviralTags3xFLAGExpressionMammalianMutationD151AAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUBQ10:LYK5_At-3xHA
Plasmid#202192PurposeExpress Arabidopsis thaliana LYK5 gene under UBQ10 promoterDepositorInsertLYSM-CONTAINING RECEPTOR-LIKE KINASE 5 (LYK5 Mustard Weed)
TagsHAExpressionPlantPromoterAtUBQ10Available SinceSept. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-Ctdnep1_C-ter
Plasmid#196525PurposeExpression of Ctdnep1_C-terDepositorInsertCtdnep1-C-ter (CTDNEP1 Human)
TagsHisExpressionBacterialMutationNo transmembrane domainPromoterT7 promoterAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST40-CES2C-ΔC
Plasmid#200555PurposeMammalian expression of secreted mouse CES2CDepositorInsertMouse Carboxylesterase 2C delta C-terminal (Ces2c Mouse)
Tags6xHis, Flag, and V5ExpressionMammalianPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTVL2-BIRC2-BIR3
Plasmid#196367Purposeprotein expression of the GST-tagged BIR3 domainDepositorInsertBIRC2 BIR3 domain
TagsHis6-GST-TEVExpressionBacterialMutationcontains only S260-Y352PromoterT7Available SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1/V5-HisA-RvCAHS8-GS-AcGFP1
Plasmid#192470PurposeTransient expression of RvCAHS8 (fly codon optimized)-GS_linker-AcGFP1 in Drosophila cellsDepositorInsertCAHS8
TagsAcGFP1ExpressionInsectPromoterAc5 promoterAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only