We narrowed to 13,244 results for: BASE;
-
Plasmid#123228PurposeMammalian expression plasmid for Env from the Q769.d22 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q769.d22) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BaL-QES.i01.c08-754*
Plasmid#123213PurposeMammalian expression plasmid for Env from the BaL HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (BaL) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-QES.i05.c06-754*
Plasmid#123275PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); C-terminal truncation; QES mutant for enhanced presentation of quaternary epitopesDepositorInsertHIV-1 (BG505) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-DU422-QES.c12-754*
Plasmid#123249PurposeMammalian expression plasmid for Env from the DU422 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (DU422) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-Q842-QES.i04.c05-754*
Plasmid#123232PurposeMammalian expression plasmid for Env from the Q842.d12 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (Q842.d12) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-191084-QES.i06.c07-754*
Plasmid#123238PurposeMammalian expression plasmid for Env from the 191084 B7-19 HIV-1 isolate; C-terminal truncation; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 (191084 B7-19) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; Premature stop co…PromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB026
Plasmid#119711PurposeTranscriptional Unit (TU) for YFP expression, obtained by combining FB/GBparts FB007+GB0053+FB008 into pDGB3alpha1R. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPromoter gpdA:YFP coding sequence:Terminator trpC
UseSynthetic BiologyAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-P2A-Puro
Plasmid#110849PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HF1-P2A-Puro
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-1xTS
Plasmid#109418PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to one tyrosine sulfation (TS) motif. VHH-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, TS, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and Tyrosine sulfation (TS) se…ExpressionBacterialPromoterT7Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogRFP (C90, JBEI-15908)
Plasmid#110143PurposeTransformation and expression of Csy4 and cogDsRed proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pC4H::cogGFP (C44, JBEI-16338)
Plasmid#110144PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
JG693: CAG-human dLbCpf1(D832A)-NLS-3xHA-3xFLAG-DmrA(X3)
Plasmid#104570PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to three DmrA domainsDepositorInsertdLbCpf1(D832A)-DmrA(x3)
Tags3x FLAG, 3x HA, and NLSExpressionMammalianMutationD832APromoterCAGAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
FN(9-10, RGE)-I27-CC
Plasmid#85396PurposeMTFM mechanosensor for integrin. Fibronectin domains 9&10 with RGE mutation fused to titan I27 domain with two cysteines for immobilization, site for p-azidophenylalanine incorporation & Cy3 labelingDepositorInsertFibronectin (FN) domains 9&10 containing RGE mutation fused to titin immunoglobulin domain (I27), containing a TAG (amber) codon
Tags6x HisExpressionBacterialMutationGRGDS motif mutated to GRGESPromoterT7Available SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only