We narrowed to 17,595 results for: Vars
-
Plasmid#115253PurposeFor mammalian expression of the human NODAL open reading frame (with a mutated Cysteine residue) with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDisplay-V5-Nxph1
Plasmid#184336PurposeExpression of V5-tagged mouse neurexophilin-1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST_LIM1224
Plasmid#182041PurposeFor expression of human paxillin LIM domains 1, 2, 2 and 4 with N-terminal GST fusion protein in E. coli.DepositorAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
GST_LIM1334
Plasmid#182040PurposeFor expression of human paxillin LIM domains 1, 3, 3 and 4 with N-terminal GST fusion protein in E. coli.DepositorAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML104-natR412
Plasmid#162042PurposeExpresses Cas9 and contains natR412 guide which targets the natR geneDepositorInsertnatR412 guide
UseCRISPRExpressionYeastAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pML107-natR854
Plasmid#162043PurposeExpresses Cas9 and contains natR854 guide which targets the natR geneDepositorInsertnatR854 guide
UseCRISPRExpressionYeastAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lmajor_gp63_10_0460_P460G_D463N_S465A
Plasmid#171645PurposeExpression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cellsDepositorInsertLmjF.10.0460 P460G D463N S465A
TagsMyc-HisExpressionMammalianMutationP460G; D463N; S465AAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH191
Plasmid#172149PurposeAccessory Plasmid for PACE of pylBCD variantsDepositorInsertPpsp gIII.2TAG, luxAB; Plpp [eG SD8] 32A-Nter; PproK pylT
ExpressionBacterialMutationgIII(P29*, Y184*); [strong promoter eG, strong RB…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJH190
Plasmid#172148PurposeAccessory Plasmid for PACE of pylBCD variantsDepositorInsertPpsp gIII.1TAG, luxAB; Plpp [eG SD8] 32A-Nter; PproK pylT
ExpressionBacterialMutationgIII(P29*); [strong promoter eG, strong RBS SD8] …Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
Negative feedback (NF) plasmid
Plasmid#169747PurposeStandalone NF circuit plasmid that has the same implementation of the NF subcircuit in Equalizers.DepositorInserttetR-P2A-eGFP
UseSynthetic BiologyExpressionMammalianPromoterCMV-tetO2Available SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS11: pTns(AvCAST)_ΔTniQ,ΔTnsD
Plasmid#168144PurposeInducible expression of AvCAST TnsA, TnsB and TnsC proteins.DepositorInsertAvCAST Tns proteins (TnsA, TnsB and TnsC)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS9: pTns(AvCAST)_ΔTniQ
Plasmid#168142PurposeInducible expression of AvCAST TnsA, TnsB, TnsC and TnsD proteins.DepositorInsertsAvCAST Tns proteins (TnsA, TnsB and TnsC)
AvTnsD
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165V
Plasmid#158965PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Valine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165V
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
VanR - F165R
Plasmid#158966PurposeWild type VanR where the residue in position 165 was mutated from Phenylalanine to Arginine. This mutation abolished the response to vanillic acid. The gene is under the control of the TEF1 promoter.DepositorInsertVanR - F165R
ExpressionYeastMutationWild type VanR from Caulobacter crescentus with m…PromoterTEF1Available SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2365 - Intron GG1 - 250bp no PATC
Plasmid#159883PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG1 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2345 - Intron GG2 - 250bp no PATC
Plasmid#159884PurposeGolden Gate compatible intron with no PATCs for negative controlsDepositorInsertIntron GG2 - 250bp no PATC
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only