We narrowed to 8,402 results for: 221
-
Plasmid#192742PurposeGateway entry vector encoding zebrafish brwd1DepositorInsertbrwd1 (brwd1 Zebrafish)
UseGateway entry vectorMutationK144W; D145E; I760T (rs512641576); Y770F (rs50744…PromoterNoneAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-erg
Plasmid#192728PurposeGateway entry vector encoding zebrafish ergDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-sh3bgr
Plasmid#192727PurposeGateway entry vector encoding zebrafish sh3bgrDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1ab
Plasmid#192726PurposeGateway entry vector encoding zebrafish dyrk1abDepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorInsertets2 (ets2 Zebrafish)
UseGateway entry vectorMutationN189D (rs502796915); S231NPromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-psmg1
Plasmid#192723PurposeGateway entry vector encoding zebrafish psmg1DepositorInsertpsmg1 (psmg1 Zebrafish)
UseGateway entry vectorMutationR96Q (rs514814252); T152M (rs501951686); T189A (r…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-get1
Plasmid#192722PurposeGateway entry vector encoding zebrafish get1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hmgn6-SE
Plasmid#192721PurposeGateway entry vector encoding mutant zebrafish hmgn6DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HMGN1-SE
Plasmid#192720PurposeGateway entry vector encoding mutant HMGN1DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-B3GALT5
Plasmid#192719PurposeGateway entry vector encoding human B3GALT5DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hmgn6
Plasmid#192715PurposeGateway entry vector encoding zebrafish hmgn6DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
DUX4_KBM pDonor221
Plasmid#187802PurposeDUX4 with KBM (p. E414-L424 deletion) entry cloneDepositorAvailable SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_BH3-4E
Plasmid#187143PurposeEntry cloneDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_R4187C
Plasmid#187141PurposeEntry cloneDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_F3194S
Plasmid#187139PurposeEntry cloneDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_H669Q
Plasmid#187137PurposeEntry cloneDepositorAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_H3962D
Plasmid#187130PurposeEntry cloneDepositorAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-HUWE1_YH/GG
Plasmid#187122PurposeEntry cloneDepositorAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TARG1
Plasmid#172577PurposeFor gateway cloning of C-terminal tagged TARG1 constructs.DepositorInsertTARG1 (OARD1 Human)
UseGateway cloningAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF221
Plasmid#88594PurposeDonor Vector containing ZNF221 transcription factor, part of the Human TFome CollectionDepositorInsertZNF221 (ZNF221 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF883
Plasmid#101608PurposeDonor Vector containing ZNF883 transcription factor, part of the Human TFome CollectionDepositorInsertZNF883 (ZNF883 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF234
Plasmid#101611PurposeDonor Vector containing ZNF234 transcription factor, part of the Human TFome CollectionDepositorInsertZNF234 (ZNF234 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF385A
Plasmid#101615PurposeDonor Vector containing ZNF385A transcription factor, part of the Human TFome CollectionDepositorInsertZNF385A (ZNF385A Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF233
Plasmid#101558PurposeDonor Vector containing ZNF233 transcription factor, part of the Human TFome CollectionDepositorInsertZNF233 (ZNF233 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF516
Plasmid#101566PurposeDonor Vector containing ZNF516 transcription factor, part of the Human TFome CollectionDepositorInsertZNF516 (ZNF516 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF579_isoform2
Plasmid#101569PurposeDonor Vector containing ZNF579 transcription factor, part of the Human TFome CollectionDepositorInsertZNF579 (ZNF579 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L5
Plasmid#101492PurposeDonor Vector containing FOXD4L5 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L5 (FOXD4L5 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L1
Plasmid#101510PurposeDonor Vector containing FOXD4L1 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L1 (FOXD4L1 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF852_isoform1
Plasmid#101533PurposeDonor Vector containing ZNF852 transcription factor, part of the Human TFome CollectionDepositorInsertZNF852 (ZNF852 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF665
Plasmid#101448PurposeDonor Vector containing ZNF665 transcription factor, part of the Human TFome CollectionDepositorInsertZNF665 (ZNF665 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-FOXD4L3
Plasmid#101491PurposeDonor Vector containing FOXD4L3 transcription factor, part of the Human TFome CollectionDepositorInsertFOXD4L3 (FOXD4L3 Human)
UseGateway shuttling vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
VHACg/pDONR221
Plasmid#172094PurposeGenomic fragment containing the upstream region and coding region of DET3/VHA-C cloned into pDONR221DepositorInsertVHA-C genomic region including 530bp upstream of the ATG, exons, introns, and no stop codon (DET3 Mustard Weed)
UseGateway entry vectorPromoter530bp upstream of VHA-C ATGAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CPL2g/pDONR221
Plasmid#172093PurposeGenomic fragment containing the upstream region and coding region of CER11/CPL2 cloned into pDONR221DepositorAvailable SinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC2A13_STOP
Plasmid#161316PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC2A13 (SLC2A13 Human)
ExpressionMammalianAvailable SinceOct. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-SLC35F1_STOP
Plasmid#161299PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC35F1 (SLC35F1 Human)
ExpressionMammalianAvailable SinceOct. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDONR221-kcnj20
Plasmid#173150PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj20 (si:ch211-113j13.2 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj12a
Plasmid#173141PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj12a (kcnj12a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj12b
Plasmid#173142PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj12b (kcnj12b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj14
Plasmid#173144PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj14 (kcnj14 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19a
Plasmid#173148PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19a (kcnj19a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj19b
Plasmid#173149PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj19b (kcnj19b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj21
Plasmid#173151PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj21 (zgc:162160 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 endAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2a
Plasmid#173127PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2a (kcnj2a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj2b
Plasmid#173128PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj2b (kcnj2b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3a
Plasmid#173129PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3a (kcnj3a Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj3b
Plasmid#173130PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj3b (kcnj3b Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj4
Plasmid#173131PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj4 (kcnj4 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj5
Plasmid#173132PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj5 (kcnj5 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#173133PurposeThis gene was cloned into the gateway middle entry vector. It can be used for generating antisense riboprobe or gene expression using a gateway system.DepositorInsertkcnj6 (kcnj6 Zebrafish)
UsePcr cloning vectorPromoterNo promoter at 5 end; T7 promoter at 3 end.Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only