-
Plasmid#184612PurposeFor expression of a fluorescent sensor for neuropeptide FF in mammalian cellsDepositorInsertMTRIA-NPFF
UseTagsExpressionMammalianMutationPromoterCAG promoterAvailable sinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCIS.MTRIA-NMB
Plasmid#184610PurposeFor expression of a fluorescent sensor for neuromedin B in mammalian cellsDepositorInsertMTRIA-NMB
UseTagsExpressionMammalianMutationPromoterCAG promoterAvailable sinceJune 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHIE043 ZF43x1 mKate2 (TUPV1)
Plasmid#138723PurposemMoClo TUPV, with ZF43x1 promoter and mKate2 in the MCSDepositorInsertZF43x1
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x1Available sinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE042 ZF43x0 mKate2 (TUPV1)
Plasmid#138722PurposemMoClo TUPV, with ZF43x0 promoter and mKate2 in the MCSDepositorInsertZF43x0
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterZF43x0Available sinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178106PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingTagsExpressionMammalianMutationPromoterTandem U6 promotersAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK389
Plasmid#206791PurposeSp.dCas9, pTet.MCP-SoxS, J23119.gRNADepositorInsertsdCas9
MCP-SoxS
scRNA
UseTagsExpressionMutationPromoterJ23119 and TetAvailable sinceSept. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterSynthetic Probasin ARRx2 and U6Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSP571
Plasmid#139498PurposeCRISPR-Cas9 plasmid to generate double strand break in STL1 locus in S. cerevisiae. Expresses both Cas9 and STL1 sgRNADepositorInsertpGPD Cas9 / sgRNA (STL162)
UseTagsExpressionYeastMutationWTPromoterpGPDAvailable sinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUB-GFP
Plasmid#11155PurposeMammalian expression vector for expression of GFP (Ubiquitin C promoter)DepositorUseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RRT8
Plasmid#166080PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RRT8 for double stranded break formation in yeast.DepositorInsertPromoter of RRT8 (RRT8 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterTagsExpressionMutationPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralTagsExpressionMutationPromoterpCMV and U6Available sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_RPL39
Plasmid#166078PurposePlasmid for constituive spCas9 expression and tet-inducible expression of sgRNA binding to the promoter of RPL39 for double stranded break formation in yeast.DepositorInsertPromoter of RPL39 (Overlaps with 5'UTR and first base of gene) (RPL39 Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromoterTet-inducibleAvailable sinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-A
Plasmid#85216PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-A
UseRetroviralTagsExpressionMammalianMutationPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Banshee-ShCit-B
Plasmid#85217PurposeShort hairpin RNAs were designed to target murine Cit (encoding Citron Rho-interacting kinase) and were subcloned into the Banshee-GFP vector for expression under control of the H1 promoter.DepositorInsertshCit-B
UseRetroviralTagsExpressionMammalianMutationPromoterH1Available sinceFeb. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(A)
Plasmid#236038PurposeThe plasmid pQdCas12a.sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (A) of gfp gene
UseCRISPRTagsExpressionMutationPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-ERT2CreERT2
Plasmid#149433Purposetamoxifen-inducible Cre recombinaseDepositorInsertERT2-Cre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAYP (pDre)
Plasmid#62709PurposeMammalian expression of Dre recombinase from the broadly active CAG promoter/enhancerDepositorInsertDre
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBigTB-CreERT2
Plasmid#149434Purposetamoxifen-inducible Cre recombinaseDepositorInsertCre-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianMutationPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only