We narrowed to 8,392 results for: crispr grnas
-
Plasmid#208821PurposeUniversal Fluorescent Surrogate Reporter for adenine and cytosine base editors. Key Construct: CMV-mCherry-CMV-eGFP* (ATAACG)-hU6-gRNA.DepositorTypeEmpty backboneTagsEGFPExpressionMammalianPromoterCMV, U6Available SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pC1300_pUB10_pcoCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197958PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by CmYLCVp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_V2_2x35Sp_HSP18t_ribozyme_AtPDS3_gRNA10
Plasmid#197959PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter and a single AtPDS3 gRNA driven by 2x35Sp and flanked by ribozymes.DepositorInsertspcoCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoter2x35S promoter and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
hsLEMD2-pX330
Plasmid#179511PurposeEncodes gRNA for human LEMD2DepositorInsertgRNA for LEMD2
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-1gRNA
Plasmid#183912PurposegRNA-expressing plasmid under Aedes aegypti AAEL017702 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017702)Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKSB-AeU6-2gRNA
Plasmid#183913PurposegRNA-expressing plasmid under Aedres aegypti AAEL017774 U6 promoterDepositorInsertgRNA scaffold for protospacer cloning into BbsI sites
PromoterAedes aegypti U6 promoter (AAEL017774)Available SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA-xylA
Plasmid#158612PurposeLow phosphate inducible gRNA array to silence the xylA and udhA promotersDepositorInsertudhA-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2-xylA
Plasmid#158613PurposeLow phosphate inducible gRNA array to silence the xylA and gltA2 promotersDepositorInsertgltA2-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf-xylA
Plasmid#158614PurposeLow phosphate inducible gRNA array to silence the xylA and zwf promotersDepositorInsertzwf-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g3 (BB24)
Plasmid#139459PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g2 (BB35)
Plasmid#139453PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
Oxford Drosophila melanogaster Genome-wide CRISPR Library
Pooled Library#64750PurposeLibrary designed for genomic targeting and screening in Drosophila cells. All possible gRNA target sites within the shared exonic regions on either DNA strand of the Drosophila genome were computed.DepositorExpressionInsectSpeciesDrosophila melanogaster, Streptococcus pyogenes, and SyntheticUseCRISPRAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b-gRNA LINE1
Plasmid#223699PurposegRNA of dPspCas13b-FTO targeting LINE1DepositorInsertgRNA target sequence for LINE1
UseCRISPRExpressionMammalianAvailable SinceAug. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-FTO-control
Plasmid#216859PurposeCIRTS RNA targeting system for targeted removal of m6A on transcript at the synapse. CIRTS-FTO-Calm3 and scramble gRNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-FTO-Calm3-U6-control gRNA
UseLentiviralTagsmCherry2ExpressionMammalianPromoterSyn1, U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only