We narrowed to 9,859 results for: REN
-
Plasmid#167645PurposeExpress FepA D34C . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA D34C
ExpressionBacterialMutationfepA with D34C mutation (Mutation is D56C based o…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP1382
Plasmid#167647PurposeExpress FepA G54C . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA G54C
ExpressionBacterialMutationfepA with G54C mutation (Mutation is G76C based o…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP718
Plasmid#167636PurposeExpress FepA T13C . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA T13C
ExpressionBacterialMutationfepA with T13C mutation (Mutation is T35C based o…Available SinceJuly 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKP1410
Plasmid#167634PurposeExpress FepA D12C . Please note that mutation numbers are not based on start codon of insert.DepositorInsertfepA D12C
ExpressionBacterialMutationFepA with D12C mutation. (Numbering based on star…Available SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT048A
Plasmid#159409PurposeConstitutive LuxR expression, controlled under J23101 E.coli promoter, and inducible Perfringolysin O (PFO) expression, controlled under V. fischeri HSL-regulated pLux (luxPR) promoterDepositorInsertpr.J23101-LuxR-pr.LuxR-PFO
UseSynthetic BiologyTagsFLAG/FLAGExpressionBacterialPromoterJ23101 and pLux promoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
DT046A
Plasmid#159407PurposeConstitutive LuxR expression, controlled under E.coli tet promoter, and inducible Perfringolysin O (PFO) expression, controlled under V. fischeri HSL-regulated pLux (luxPR) promoterDepositorInsertpr.tet-LuxR-pr.LuxR-PFO
UseSynthetic BiologyTagsFLAG/FLAGExpressionBacterialPromotertet and pLux promoterAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2H_Psyn-sgRNAflaB
Plasmid#149561PurposeflaB gRNA expression in B. burgdorferiDepositorInsertsgRNAflaB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBSV2H_Psyn-sgRNArodA
Plasmid#149569PurposerodA gRNA expression in B. burgdorferiDepositorInsertsgRNArodA
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGST-POLA1-N0
Plasmid#160983PurposeExpress a fragment of mouse Pola1 proteinDepositorAvailable SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGST-POLA1-N2
Plasmid#160985PurposeExpress a fragment of mouse Pola1 proteinDepositorAvailable SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGST-POLA1-N1
Plasmid#160984PurposeExpress a fragment of mouse Pola1 proteinDepositorAvailable SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2H_Psyn-sgRNAftsI
Plasmid#149563PurposeftsI gRNA expression in B. burgdorferiDepositorInsertsgRNAftsI
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2H_Psyn-sgRNAmreB
Plasmid#149567PurposemreB gRNA expression in B. burgdorferiDepositorInsertsgRNAmreB
UseCRISPRExpressionBacterialPromoterPsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPS1-Venus
Plasmid#133118PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pYPS1 driving a Venus.DepositorInsertpYPS1-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMK2-Venus
Plasmid#133119PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pCMK2 driving a Venus.DepositorInsertpCMK2-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGYP7-Venus
Plasmid#133120PurposePlasmid contains a reporter gene for Crz1. The 1000bp promoter of the gene pGYP7 driving a Venus.DepositorInsertpGYP7-YFP
ExpressionBacterial and YeastAvailable SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ211_WT_med
Plasmid#128849PurposeMedium copy number plasmid for expression of E. coli flagellin from its natural promoterDepositorInsertFlagellin
ExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJ211_rha_WT_hi
Plasmid#128853PurposeHigh copy number plasmid for expression of E. coli flagellin from a rhamnose-inducible promoterDepositorInsertFlagellin
ExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-3'UTR
Plasmid#136042PurposeUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3A-CDS
Plasmid#136043PurposeUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only