We narrowed to 43,201 results for: gats
-
Plasmid#82846PurposeGateway Donor vector containing PIK3CA, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_PIK3CA_p.Q137L
Plasmid#82817PurposeGateway Donor vector containing PIK3CA, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.R204P
Plasmid#82841PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.D389Y
Plasmid#82842PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.L268P
Plasmid#82831PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.S144F
Plasmid#82790PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.W497L
Plasmid#82793PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.S102L
Plasmid#82778PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_ARAF_p.S214F
Plasmid#82901PurposeGateway Donor vector containing ARAF , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.P367R
Plasmid#82851PurposeGateway Donor vector containing BRAF, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAX_p.R60del
Plasmid#82740PurposeGateway Donor vector containing MAX, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_MAX_p.R35L
Plasmid#82732PurposeGateway Donor vector containing MAX, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BRAF_p.W450L
Plasmid#82830PurposeGateway Donor vector containing BRAF , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-cMyc-UBC_K7R-IRES-Blasti
Plasmid#242463PurposeExpresses human UBC protein with an N-terminal cMyc tag enabling UBC pull down along with a blasticidin selection marker. The K7R mutations prevent ubiquitin chain elongation.DepositorAvailable SinceNov. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Sun1-2xsfGFP-6xMYC-pA (JDW 694)
Plasmid#242588PurposeA CMV driven expression vector containing a Sun1-2xsfGFP for labeling nuclear envenlope.DepositorAvailable SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTol2-Ubi-lsl-EGFP-nls-mCherry:fli1aep-CreI-zf1-BFP (JDW 1236)
Plasmid#229816PurposeA Tol2 based expression vector containing an Ubi driven loxP flanked GFP followed by an nls-mCherry reporter with fli1-TagBFP-zCre in the opposite direction.DepositorInsertloxp-EGFP-stop-lox
UseTol2 based expression vectorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Hsp70-H2B-mCerulean-lsl-mScarlet-fli1-zCre-I-BFP (JDW 1233)
Plasmid#229841PurposeA Tol2 based expression vector with the Hsp70 promoter driving a cre dependent switch reporter. Contains an endothelial driven creDepositorInsertloxp-H2B-mCerulean-2xStop-loxP
UseCre/Lox; Tol2 based expression vectorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRev-erba-hSyn-mCherry-KASH
Plasmid#223226PurposeguideRNA targeting the mouse Rev-erb alpha (Nr1d1)DepositorInsertNr1d1 (Nr1d1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only