We narrowed to 18,414 results for: try;
-
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mclover-YTH-IDR2
Plasmid#177122PurposeBacterial expression of YTH-IDR2 fragment of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH and IDR2 domains) (YTHDC1 Human)
TagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH and IDR2 domains only (IDR1 deletion)PromoterT7Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2F04
Plasmid#70901PurposeGateway entry cloneDepositorInsertmod(mdg4) (mod(mdg4) Fly)
UseGateway entry vectorAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B
Plasmid#133308PurposeExpression of luciferase driven by eIF3B promoter regionDepositorAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE2 mutant
Plasmid#133309PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2DepositorInserteIF3B promoter MBE2 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationgccacatgcacc changed to gcAaAaAAcaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
MultiSite Gateway plasmid toolKit
Plasmid Kit#1000000050PurposeCloning kit for constructing fully-customizable three-part fusion proteins, based on MultiSite Gateway from Life Technologies. 12 promoter-less Gateway entry clones, N- and C-term flanking modulesDepositorAvailable SinceJune 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAS mutant clone collection
Plasmid Kit#1000000089PurposeWild-type and mutant HRAS, NRAS, KRAS4a and KRAS4b gene plasmids as Gateway entry clonesDepositorAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Fungal Toolkit for Modular Cloning (FTK)
Plasmid Kit#1000000191PurposeConsists of 96 genetic parts as Modular Cloning-compatible entry vectors, including synthetic and native promoters, terminators, selection markers, and CRISPR components, for filamentous fungi.DepositorAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
E. coli K-12 MG1655_rLP5(nth-ydgR)
Bacterial Strain#110245PurposeE. coli K-12 MG1655 with Landing Pad engineered into the nth-ydgR intergenic region. The Landing Pad consists of floxed mCherry,Chlor that are cotranscribed.DepositorBacterial ResistanceChloramphenicolAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
TB205 △trpC
Bacterial Strain#230038PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for tryptophanDepositorBacterial ResistanceNoneAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
TB204 △trpC
Bacterial Strain#230037PurposeFluorescently labelled (GFP) E. coli, auxotrophic for tryptophanDepositorBacterial ResistanceNoneAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only