We narrowed to 39,638 results for: STI
-
Plasmid#114083PurposeCAG promoter expression plasmid for human codon optimized enAsBE1.3DepositorInsertDNase-inactive (D908A) enAsCas12a (E174R/S542R/K548R) fused to N-terminal rAPOBEC1 and C-terminal UGI (enAsBE1.3)
TagsSV40 NLSExpressionMammalianMutationE174R, S542R, K548R and D908A, human codon optimi…Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
His-SUMO-Rab10 Q68L
Plasmid#236720PurposeExpresses Rab10 Q68L with His tag and SUMO cleavage sequenceDepositorArticleAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1897)
Plasmid#114074PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RVR (S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
The Human Druggable CRISPR library
Pooled Library#200013PurposeKnockout library containing ~10,000 sgRNAs targeting 1,980 human druggable genes (5 sgRNAs per gene and 100 non-targeting control sgRNAs).DepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceMay 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lourido Toxoplasma CRISPR Library V1
Pooled Library#80636PurposeKnockout library targeting 8,158 predicted protein-coding gene in Toxoplasma gondii.DepositorAvailable SinceSept. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNJP
Plasmid#115494PurposeExpression vector for NLS-iRFP-NLS, JNK KTR-mCherry, and mKO-MK2 in mammalian cellsDepositorTagsiRFP, mCherry, and mKOExpressionMammalianMutationmCherry S227F, mCherry G229R, mKO V211GPromoterCAGAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
Watermelon
Pooled Library#155257PurposeLineage tracing libraryDepositorExpressionMammalianUseLentiviralAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Human Transporter Knockout Library with UMIs
Pooled Library#221409PurposegRNA library to test the impact of transporters on biological processesDepositorSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Pooled sgRNA Libraries Set 1 for Pseudomonas aeruginosa PA14
Pooled Library#234855PurposeA CRISPRi library for inducible, genome-wide gene repression in Pseudomonas aeruginosa PA14.DepositorExpressionBacterialAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1H_M flap
Plasmid#236718PurposeExpresses PPM1H with PPM1M flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1H flap domain replaced with PPM1M flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5D HA-PPM1M_H flap
Plasmid#236719PurposeExpresses PPM1M with PPM1H flap domain sequenceDepositorArticleTagsHAExpressionMammalianMutationPPM1M flap domain replaced with PPM1H flap domainPromoterCMVAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
C321
Bacterial Strain#48999PurposeRecoded E. coli MG1655 strain with wt UAG termination function (RF1 is still present)DepositorBacterial ResistanceAmpicillinSpeciesEscherichia coliAvailable SinceOct. 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ spike_del19
Plasmid#155297PurposeExpression of spike with C-term deletion of 19 aa, used to generate high efficiency SARS-CoV-2-pseudotyped lentiviral particlesDepositorInsertSARS-Cov2 spike_deleted (S SARS-Cov2)
UseGeneration of sars-cov-2-pseudotyped lentiviral p…MutationDeletion in C-term 19 aa of spikePromoterCMVAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Human SLC overexpression library
Pooled Library#213694PurposeInducible barcoded library with 467 codon-optimized cDNAs with UMIs to test the impact of SLC transporters on biological processes.DepositorExpressionMammalianSpeciesHomo sapiensUseLentiviralAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTF-CRISPRai
Pooled Library#122131PurposeIncreases transcriptional repression of genes encoding transcription factors in combination with dCas9 repression systems, such as the dCas9-KRAB system.DepositorExpressionMammalianSpeciesMus musculusUseCRISPR and LentiviralAvailable SinceApril 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Human ABC Transporter Knockout Sub-library with UMIs
Pooled Library#221410PurposegRNA library to test the impact of transporters on biological processes (subset: ABC transporters and controls)DepositorSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only