We narrowed to 12,290 results for: shRNA
-
Plasmid#177763PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459_GRHL1-exon8
Plasmid#177764PurposesgRNA for CRISPR/Cas9-mediated deletion of human GRHL1DepositorInsertGRHL1 (GRHL1 Human)
UseCRISPRAvailable SinceApril 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo2_Nterm
Plasmid#170920PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago2 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgAgo1_Nterm
Plasmid#170921PurposeExpresses spCas9 and sgRNA targeting the N-terminus of Ago1 for N-terminal taggingDepositorAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-DN(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168243Purpose"Dominant negative control of the assay to rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-DN
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-CA(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168244Purpose"Rescue Rac-CA expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-CA
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB131
Plasmid#180174PurposepAAV construct GluN1A714L (shRNA resistant)DepositorAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.4.hSyn.flex.H2B.RFP
Plasmid#170386PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.H2B.RFP
Plasmid#170370PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.flex.H2B.RFP
Plasmid#170376PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-U6-UL29-U3-UL8
Plasmid#166685PurposeTo express gRNA expression cassette simultaneously targeting two genes: UL8 and UL29 (non-EGFP version).DepositorAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pSIN-Olfr2
Plasmid#175935Purposeknockout mouse Olfr2DepositorInsertOlfr2 gRNA (Or6a2 Mouse)
UseRetroviralAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.13.hSyn.H2B.RFP
Plasmid#170372PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only